EMAIL THIS PAGE TO A FRIEND

FAM212A

family with sequence similarity 212, member A

53 Gene Product Result for
Synonyms: C3orf54 INKA1
UniProtKB ID: Q96EL1
Gene ID:
Mouse(68176) family with sequence similarity 212, member A
Rat(316001) family with sequence similarity 212, member A
chicken(101665832) family with sequence similarity 212, member A
chicken(101751145) family with sequence similarity 212, member A
cow(616365) family with sequence similarity 212, member A
domestic cat(101088559) family with sequence similarity 212, member A
dog(484764) family with sequence similarity 212, member A
sheep(101116942) family with sequence similarity 212, member A
domestic guinea pig(100736051) family with sequence similarity 212, member A
naked mole-rat(101719156) family with sequence similarity 212, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203370 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203370 Rosetta Predictions human pricing
NM_001108187 Rosetta Predictions rat pricing
NM_026597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196701 predicted 694
2 SASI_Hs01_00196702 predicted 643
3 SASI_Hs01_00196705 predicted 735
4 SASI_Hs01_00196706 predicted 701
5 SASI_Hs01_00196707 predicted 615
6 SASI_Hs02_00373294 predicted 617
7 SASI_Hs02_00373295 predicted 614
8 SASI_Hs01_00196709 predicted 932
9 SASI_Hs01_00196710 predicted 433
10 SASI_Hs02_00373296 predicted 895
11 SASI_Hs01_00196703 predicted 796
12 SASI_Hs01_00196704 predicted 641
13 SASI_Hs01_00196708 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108187 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236184 predicted 552
2 SASI_Rn02_00236185 predicted 333
3 SASI_Rn02_00236186 predicted 462
4 SASI_Rn02_00236187 predicted 454
5 SASI_Rn02_00236188 predicted 301
6 SASI_Rn02_00236189 predicted 816
7 SASI_Rn02_00236190 predicted 514
8 SASI_Rn02_00236191 predicted 635
9 SASI_Rn02_00236192 predicted 622
10 SASI_Rn02_00236193 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168469 predicted 519
2 SASI_Mm01_00168470 predicted 498
3 SASI_Mm01_00168471 predicted 483
4 SASI_Mm01_00168472 predicted 262
5 SASI_Mm01_00168473 predicted 779
6 SASI_Mm01_00168474 predicted 466
7 SASI_Mm01_00168475 predicted 252
8 SASI_Mm01_00168476 predicted 423
9 SASI_Mm01_00168477 predicted 497
10 SASI_Mm01_00168478 predicted 609
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026597
VALIDATED
FAM212A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 212, member A
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026597.1-499s1c1
Sequence:CCGGGCGTTTCTCAGTCAGTGACATCTCGAGATGTCACTGACTGAGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026597.1-699s1c1
Sequence:CCGGCTGATTTAGTTCACAATTGGACTCGAGTCCAATTGTGAACTAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026597.2-695s21c1
Sequence:CCGGTTGCTGATTTAGTTCACAATTCTCGAGAATTGTGAACTAAATCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026597.2-343s21c1
Sequence:CCGGGTAGCAGAAGACAAGGGTTTACTCGAGTAAACCCTTGTCTTCTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026597.2-272s21c1
Sequence:CCGGAGTTCAGGGCCTCGGATGTTTCTCGAGAAACATCCGAGGCCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026597.2-474s21c1
Sequence:CCGGTCGAGAACGTCCACCTCATAGCTCGAGCTATGAGGTGGACGTTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026597
VALIDATED
FAM212A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 212, member A
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026597.1-499s1c1
Sequence:CCGGGCGTTTCTCAGTCAGTGACATCTCGAGATGTCACTGACTGAGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026597.1-699s1c1
Sequence:CCGGCTGATTTAGTTCACAATTGGACTCGAGTCCAATTGTGAACTAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026597.2-695s21c1
Sequence:CCGGTTGCTGATTTAGTTCACAATTCTCGAGAATTGTGAACTAAATCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026597.2-343s21c1
Sequence:CCGGGTAGCAGAAGACAAGGGTTTACTCGAGTAAACCCTTGTCTTCTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026597.2-272s21c1
Sequence:CCGGAGTTCAGGGCCTCGGATGTTTCTCGAGAAACATCCGAGGCCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026597.2-474s21c1
Sequence:CCGGTCGAGAACGTCCACCTCATAGCTCGAGCTATGAGGTGGACGTTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026597
VALIDATED
FAM212A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 212, member A
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026597.1-499s1c1
Sequence:CCGGGCGTTTCTCAGTCAGTGACATCTCGAGATGTCACTGACTGAGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026597.1-699s1c1
Sequence:CCGGCTGATTTAGTTCACAATTGGACTCGAGTCCAATTGTGAACTAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026597.2-695s21c1
Sequence:CCGGTTGCTGATTTAGTTCACAATTCTCGAGAATTGTGAACTAAATCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026597.2-343s21c1
Sequence:CCGGGTAGCAGAAGACAAGGGTTTACTCGAGTAAACCCTTGTCTTCTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026597.2-272s21c1
Sequence:CCGGAGTTCAGGGCCTCGGATGTTTCTCGAGAAACATCCGAGGCCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026597.2-474s21c1
Sequence:CCGGTCGAGAACGTCCACCTCATAGCTCGAGCTATGAGGTGGACGTTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203370
VALIDATED
FAM212A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 212, member A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203370.1-452s1c1
Sequence:CCGGCGAGAGGAAGAACTGCCTGTACTCGAGTACAGGCAGTTCTTCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203370.1-453s1c1
Sequence:CCGGGAGAGGAAGAACTGCCTGTATCTCGAGATACAGGCAGTTCTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203370.1-711s21c1
Sequence:CCGGTTGCTGACTTGGTGCACAACTCTCGAGAGTTGTGCACCAAGTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203370.1-454s21c1
Sequence:CCGGAGAGGAAGAACTGCCTGTATCCTCGAGGATACAGGCAGTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203370.1-563s21c1
Sequence:CCGGAGTGTACCACCTGTCCACCATCTCGAGATGGTGGACAGGTGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203370.1-348s21c1
Sequence:CCGGAGGAAGCAGTGGTGACAGAAGCTCGAGCTTCTGTCACCACTGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203370
VALIDATED
FAM212A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 212, member A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203370.1-452s1c1
Sequence:CCGGCGAGAGGAAGAACTGCCTGTACTCGAGTACAGGCAGTTCTTCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203370.1-453s1c1
Sequence:CCGGGAGAGGAAGAACTGCCTGTATCTCGAGATACAGGCAGTTCTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203370.1-711s21c1
Sequence:CCGGTTGCTGACTTGGTGCACAACTCTCGAGAGTTGTGCACCAAGTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203370.1-454s21c1
Sequence:CCGGAGAGGAAGAACTGCCTGTATCCTCGAGGATACAGGCAGTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203370.1-563s21c1
Sequence:CCGGAGTGTACCACCTGTCCACCATCTCGAGATGGTGGACAGGTGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203370.1-348s21c1
Sequence:CCGGAGGAAGCAGTGGTGACAGAAGCTCGAGCTTCTGTCACCACTGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203370
VALIDATED
FAM212A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 212, member A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203370.1-452s1c1
Sequence:CCGGCGAGAGGAAGAACTGCCTGTACTCGAGTACAGGCAGTTCTTCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203370.1-453s1c1
Sequence:CCGGGAGAGGAAGAACTGCCTGTATCTCGAGATACAGGCAGTTCTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203370.1-711s21c1
Sequence:CCGGTTGCTGACTTGGTGCACAACTCTCGAGAGTTGTGCACCAAGTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203370.1-454s21c1
Sequence:CCGGAGAGGAAGAACTGCCTGTATCCTCGAGGATACAGGCAGTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203370.1-563s21c1
Sequence:CCGGAGTGTACCACCTGTCCACCATCTCGAGATGGTGGACAGGTGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203370.1-348s21c1
Sequence:CCGGAGGAAGCAGTGGTGACAGAAGCTCGAGCTTCTGTCACCACTGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks