EMAIL THIS PAGE TO A FRIEND

FAM212B

family with sequence similarity 212, member B

65 Gene Product Result for
Synonyms: C1orf183
UniProtKB ID: Q9NTI7, B3KP38, B4DF94, Q9NTI6
Gene ID:
Mouse(109050) family with sequence similarity 212, member B
Rat(310764) family with sequence similarity 212, member B
cow(616754) chromosome 3 open reading frame, human C1orf183
domestic cat(101095355) family with sequence similarity 212, member B
naked mole-rat(101699589) family with sequence similarity 212, member B
domestic guinea pig(100713885) family with sequence similarity 212, member B
sheep(101107251) family with sequence similarity 212, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019099 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175398 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175398 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175398 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019099 Rosetta Predictions human pricing
NM_198926 Rosetta Predictions human pricing
NM_001107713 Rosetta Predictions rat pricing
NM_175398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352715 predicted 469
2 SASI_Hs01_00110600 predicted 572
3 SASI_Hs01_00110602 predicted 1004
4 SASI_Hs01_00110603 predicted 459
5 SASI_Hs01_00110604 predicted 766
6 SASI_Hs01_00110606 predicted 855
7 SASI_Hs01_00110607 predicted 764
8 SASI_Hs02_00352716 predicted 1520
9 SASI_Hs02_00352717 predicted 1043
10 SASI_Hs02_00352718 predicted 1061
11 SASI_Hs01_00110601 predicted 713
12 SASI_Hs01_00110605 predicted 1042
13 SASI_Hs01_00110608 predicted 480
14 SASI_Hs01_00110609 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372418 predicted 351
2 SASI_Hs01_00157491 predicted 451
3 SASI_Hs01_00157493 predicted 883
4 SASI_Hs01_00157494 predicted 345
5 SASI_Hs01_00157495 predicted 646
6 SASI_Hs01_00157497 predicted 740
7 SASI_Hs01_00157498 predicted 652
8 SASI_Hs02_00372419 predicted 1403
9 SASI_Hs02_00372420 predicted 927
10 SASI_Hs02_00372421 predicted 946
11 SASI_Hs01_00157492 predicted 597
12 SASI_Hs01_00157496 predicted 923
13 SASI_Hs01_00157499 predicted 371
14 SASI_Hs01_00157500 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231535 predicted 494
2 SASI_Rn02_00231536 predicted 960
3 SASI_Rn02_00231537 predicted 593
4 SASI_Rn02_00231538 predicted 861
5 SASI_Rn02_00231539 predicted 900
6 SASI_Rn02_00231540 predicted 636
7 SASI_Rn02_00231541 predicted 634
8 SASI_Rn02_00231542 predicted 761
9 SASI_Rn02_00231543 predicted 1002
10 SASI_Rn02_00231544 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054003 predicted 602
2 SASI_Mm01_00054004 predicted 809
3 SASI_Mm01_00054005 predicted 665
4 SASI_Mm01_00054006 predicted 521
5 SASI_Mm01_00054007 predicted 411
6 SASI_Mm01_00054008 predicted 841
7 SASI_Mm01_00054009 predicted 704
8 SASI_Mm01_00054010 predicted 946
9 SASI_Mm01_00054011 predicted 698
10 SASI_Mm02_00346250 predicted 245
11 SASI_Mm01_00054012 predicted 867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019099
FAM212B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 212, member B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019099.4-601s21c1
Sequence:CCGGACTGGACCTCCACGTTGATGTCTCGAGACATCAACGTGGAGGTCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019099.4-210s21c1
Sequence:CCGGTGCTATCTCCGTCGCCTCAAACTCGAGTTTGAGGCGACGGAGATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019099.3-463s1c1
Sequence:CCGGGCACCAAGTTTCCATCCCATACTCGAGTATGGGATGGAAACTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019099.3-771s1c1
Sequence:CCGGGCCCTGACAGCAAACATCTTTCTCGAGAAAGATGTTTGCTGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019099.3-1010s1c1
Sequence:CCGGCTCACCCTCAGGATTTGATATCTCGAGATATCAAATCCTGAGGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019099.3-887s1c1
Sequence:CCGGCCGCTCACAGAAGGTCAAGAACTCGAGTTCTTGACCTTCTGTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019099.3-236s1c1
Sequence:CCGGTGATGGCTTACAGGATCAGATCTCGAGATCTGATCCTGTAAGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019099
FAM212B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 212, member B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019099.4-601s21c1
Sequence:CCGGACTGGACCTCCACGTTGATGTCTCGAGACATCAACGTGGAGGTCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019099.4-210s21c1
Sequence:CCGGTGCTATCTCCGTCGCCTCAAACTCGAGTTTGAGGCGACGGAGATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019099.3-463s1c1
Sequence:CCGGGCACCAAGTTTCCATCCCATACTCGAGTATGGGATGGAAACTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019099.3-771s1c1
Sequence:CCGGGCCCTGACAGCAAACATCTTTCTCGAGAAAGATGTTTGCTGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019099.3-1010s1c1
Sequence:CCGGCTCACCCTCAGGATTTGATATCTCGAGATATCAAATCCTGAGGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019099.3-887s1c1
Sequence:CCGGCCGCTCACAGAAGGTCAAGAACTCGAGTTCTTGACCTTCTGTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019099.3-236s1c1
Sequence:CCGGTGATGGCTTACAGGATCAGATCTCGAGATCTGATCCTGTAAGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019099
FAM212B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 212, member B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019099.4-601s21c1
Sequence:CCGGACTGGACCTCCACGTTGATGTCTCGAGACATCAACGTGGAGGTCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019099.4-210s21c1
Sequence:CCGGTGCTATCTCCGTCGCCTCAAACTCGAGTTTGAGGCGACGGAGATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019099.3-463s1c1
Sequence:CCGGGCACCAAGTTTCCATCCCATACTCGAGTATGGGATGGAAACTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019099.3-771s1c1
Sequence:CCGGGCCCTGACAGCAAACATCTTTCTCGAGAAAGATGTTTGCTGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019099.3-1010s1c1
Sequence:CCGGCTCACCCTCAGGATTTGATATCTCGAGATATCAAATCCTGAGGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019099.3-887s1c1
Sequence:CCGGCCGCTCACAGAAGGTCAAGAACTCGAGTTCTTGACCTTCTGTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019099.3-236s1c1
Sequence:CCGGTGATGGCTTACAGGATCAGATCTCGAGATCTGATCCTGTAAGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175398
FAM212B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 212, member B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175398.3-1801s21c1
Sequence:CCGGGGCCGATCTCATGGTTATAAACTCGAGTTTATAACCATGAGATCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175398.3-2511s1c1
Sequence:CCGGCCTATCTCAGAACGATTAATCCTCGAGGATTAATCGTTCTGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175398.3-608s21c1
Sequence:CCGGGTGGGTAACTGGCTAGATTTACTCGAGTAAATCTAGCCAGTTACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175398.3-910s21c1
Sequence:CCGGAGAGCCCAGACATATTGAAACCTCGAGGTTTCAATATGTCTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175398.3-239s21c1
Sequence:CCGGCTACAAGTGCAGACGGCATTGCTCGAGCAATGCCGTCTGCACTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175398.3-705s21c1
Sequence:CCGGGAGAGCTGGGTCGTAAGTTTGCTCGAGCAAACTTACGACCCAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175398.3-608s1c1
Sequence:CCGGGTGGGTAACTGGCTAGATTTACTCGAGTAAATCTAGCCAGTTACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175398
FAM212B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 212, member B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175398.3-1801s21c1
Sequence:CCGGGGCCGATCTCATGGTTATAAACTCGAGTTTATAACCATGAGATCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175398.3-2511s1c1
Sequence:CCGGCCTATCTCAGAACGATTAATCCTCGAGGATTAATCGTTCTGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175398.3-608s21c1
Sequence:CCGGGTGGGTAACTGGCTAGATTTACTCGAGTAAATCTAGCCAGTTACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175398.3-910s21c1
Sequence:CCGGAGAGCCCAGACATATTGAAACCTCGAGGTTTCAATATGTCTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175398.3-239s21c1
Sequence:CCGGCTACAAGTGCAGACGGCATTGCTCGAGCAATGCCGTCTGCACTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175398.3-705s21c1
Sequence:CCGGGAGAGCTGGGTCGTAAGTTTGCTCGAGCAAACTTACGACCCAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175398.3-608s1c1
Sequence:CCGGGTGGGTAACTGGCTAGATTTACTCGAGTAAATCTAGCCAGTTACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175398
FAM212B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 212, member B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175398.3-1801s21c1
Sequence:CCGGGGCCGATCTCATGGTTATAAACTCGAGTTTATAACCATGAGATCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175398.3-2511s1c1
Sequence:CCGGCCTATCTCAGAACGATTAATCCTCGAGGATTAATCGTTCTGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175398.3-608s21c1
Sequence:CCGGGTGGGTAACTGGCTAGATTTACTCGAGTAAATCTAGCCAGTTACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175398.3-910s21c1
Sequence:CCGGAGAGCCCAGACATATTGAAACCTCGAGGTTTCAATATGTCTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175398.3-239s21c1
Sequence:CCGGCTACAAGTGCAGACGGCATTGCTCGAGCAATGCCGTCTGCACTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175398.3-705s21c1
Sequence:CCGGGAGAGCTGGGTCGTAAGTTTGCTCGAGCAAACTTACGACCCAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175398.3-608s1c1
Sequence:CCGGGTGGGTAACTGGCTAGATTTACTCGAGTAAATCTAGCCAGTTACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks