EMAIL THIS PAGE TO A FRIEND

FAM213A

family with sequence similarity 213, member A

Synonyms: C10orf58 PAMM
UniProtKB ID: Q9BRX8, B2RD81, Q6UW08, Q8N2K3, Q8NBK9, Q96JR0
Gene ID:
Mouse(70564) family with sequence similarity 213, member A
Rat(290529) family with sequence similarity 213, member A
sheep(101108716) family with sequence similarity 213, member A
domestic guinea pig(100728119) family with sequence similarity 213, member A
naked mole-rat(101711520) family with sequence similarity 213, member A
dog(479261) family with sequence similarity 213, member A
cow(534049) chromosome 28 open reading frame, human C10orf58
domestic cat(101080829) family with sequence similarity 213, member A
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032333 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032333 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032333 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032333 Rosetta Predictions human pricing
NM_001008297 Rosetta Predictions rat pricing
NM_027464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154724 predicted 800
2 SASI_Hs01_00154725 predicted 548
3 SASI_Hs01_00154726 predicted 735
4 SASI_Hs01_00154727 predicted 814
5 SASI_Hs01_00154728 predicted 612
6 SASI_Hs01_00154729 predicted 407
7 SASI_Hs01_00154730 predicted 432
8 SASI_Hs01_00154731 predicted 488
9 SASI_Hs01_00154732 predicted 293
10 SASI_Hs02_00359711 predicted 433
11 SASI_Hs01_00154733 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089772 predicted 395
2 SASI_Rn01_00089773 predicted 732
3 SASI_Rn02_00199000 predicted 863
4 SASI_Rn01_00089774 predicted 817
5 SASI_Rn01_00089775 predicted 854
6 SASI_Rn01_00089776 predicted 897
7 SASI_Rn01_00089777 predicted 722
8 SASI_Rn01_00089779 predicted 679
9 SASI_Rn01_00089780 predicted 539
10 SASI_Rn01_00089781 predicted 835
11 SASI_Rn01_00089778 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095918 predicted 842
2 SASI_Mm01_00095919 predicted 482
3 SASI_Mm01_00095920 predicted 640
4 SASI_Mm01_00095922 predicted 644
5 SASI_Mm01_00095923 predicted 402
6 SASI_Mm01_00095924 predicted 351
7 SASI_Mm01_00095925 predicted 279
8 SASI_Mm01_00095926 predicted 861
9 SASI_Mm02_00332256 predicted 366
10 SASI_Mm02_00332257 predicted 834
11 SASI_Mm01_00095917 predicted 853
12 SASI_Mm01_00095921 predicted 572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032333
VALIDATED
FAM213A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 213, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032333.2-1022s1c1
Sequence:CCGGCCTGGGAAATAGGAGGCTTAACTCGAGTTAAGCCTCCTATTTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032333.2-541s1c1
Sequence:CCGGCGGAAGATGATGTTTATGGGACTCGAGTCCCATAAACATCATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032333.2-466s1c1
Sequence:CCGGGTGAAGGATTTCCAGCCTTATCTCGAGATAAGGCTGGAAATCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032333.2-628s1c1
Sequence:CCGGGAAGGAGAAGGCTTCATCCTTCTCGAGAAGGATGAAGCCTTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032333.2-450s1c1
Sequence:CCGGGCACATCAGGACTGAAGTGAACTCGAGTTCACTTCAGTCCTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032333.2-293s1c1
Sequence:CCGGCTTTCAAAGCAAAGGAGCTATCTCGAGATAGCTCCTTTGCTTTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032333.2-756s1c1
Sequence:CCGGGATGATCAAACCACAGACTTTCTCGAGAAAGTCTGTGGTTTGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032333.2-716s1c1
Sequence:CCGGGAGACAAAGTAAACCTACTTTCTCGAGAAAGTAGGTTTACTTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032333.2-745s1c1
Sequence:CCGGGAAGCTGCTAAGATGATCAAACTCGAGTTTGATCATCTTAGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032333
VALIDATED
FAM213A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 213, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032333.2-1022s1c1
Sequence:CCGGCCTGGGAAATAGGAGGCTTAACTCGAGTTAAGCCTCCTATTTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032333.2-541s1c1
Sequence:CCGGCGGAAGATGATGTTTATGGGACTCGAGTCCCATAAACATCATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032333.2-466s1c1
Sequence:CCGGGTGAAGGATTTCCAGCCTTATCTCGAGATAAGGCTGGAAATCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032333.2-628s1c1
Sequence:CCGGGAAGGAGAAGGCTTCATCCTTCTCGAGAAGGATGAAGCCTTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032333.2-450s1c1
Sequence:CCGGGCACATCAGGACTGAAGTGAACTCGAGTTCACTTCAGTCCTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032333.2-293s1c1
Sequence:CCGGCTTTCAAAGCAAAGGAGCTATCTCGAGATAGCTCCTTTGCTTTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032333.2-756s1c1
Sequence:CCGGGATGATCAAACCACAGACTTTCTCGAGAAAGTCTGTGGTTTGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032333.2-716s1c1
Sequence:CCGGGAGACAAAGTAAACCTACTTTCTCGAGAAAGTAGGTTTACTTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032333.2-745s1c1
Sequence:CCGGGAAGCTGCTAAGATGATCAAACTCGAGTTTGATCATCTTAGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032333
VALIDATED
FAM213A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 213, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032333.2-1022s1c1
Sequence:CCGGCCTGGGAAATAGGAGGCTTAACTCGAGTTAAGCCTCCTATTTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032333.2-541s1c1
Sequence:CCGGCGGAAGATGATGTTTATGGGACTCGAGTCCCATAAACATCATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032333.2-466s1c1
Sequence:CCGGGTGAAGGATTTCCAGCCTTATCTCGAGATAAGGCTGGAAATCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032333.2-628s1c1
Sequence:CCGGGAAGGAGAAGGCTTCATCCTTCTCGAGAAGGATGAAGCCTTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032333.2-450s1c1
Sequence:CCGGGCACATCAGGACTGAAGTGAACTCGAGTTCACTTCAGTCCTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032333.2-293s1c1
Sequence:CCGGCTTTCAAAGCAAAGGAGCTATCTCGAGATAGCTCCTTTGCTTTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032333.2-756s1c1
Sequence:CCGGGATGATCAAACCACAGACTTTCTCGAGAAAGTCTGTGGTTTGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032333.2-716s1c1
Sequence:CCGGGAGACAAAGTAAACCTACTTTCTCGAGAAAGTAGGTTTACTTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032333.2-745s1c1
Sequence:CCGGGAAGCTGCTAAGATGATCAAACTCGAGTTTGATCATCTTAGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027464
VALIDATED
FAM213A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 213, member A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027464.1-496s1c1
Sequence:CCGGGAGGCGGAAGATGATGTTCATCTCGAGATGAACATCATCTTCCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027464.1-431s1c1
Sequence:CCGGGATTTCCAACCTTACTTCAAACTCGAGTTTGAAGTAAGGTTGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027464.1-1074s1c1
Sequence:CCGGCGGTATTTGAAGTGAAGTTTACTCGAGTAAACTTCACTTCAAATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027464.1-954s1c1
Sequence:CCGGCCCAGACAGAACAGAGTTCAACTCGAGTTGAACTCTGTTCTGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027464.1-349s1c1
Sequence:CCGGGATGTCCTTGAAGCCCAAGTTCTCGAGAACTTGGGCTTCAAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198479    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027464.1-1072s1c1
Sequence:CCGGGCCGGTATTTGAAGTGAAGTTCTCGAGAACTTCACTTCAAATACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027464.3-1073s21c1
Sequence:CCGGCGGTATTTGAAGTGAAGTTTACTCGAGTAAACTTCACTTCAAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027464.3-953s21c1
Sequence:CCGGCCCAGACAGAACAGAGTTCAACTCGAGTTGAACTCTGTTCTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027464.3-430s21c1
Sequence:CCGGGATTTCCAACCTTACTTCAAACTCGAGTTTGAAGTAAGGTTGGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027464.3-495s21c1
Sequence:CCGGGAGGCGGAAGATGATGTTCATCTCGAGATGAACATCATCTTCCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027464
VALIDATED
FAM213A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 213, member A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027464.1-496s1c1
Sequence:CCGGGAGGCGGAAGATGATGTTCATCTCGAGATGAACATCATCTTCCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027464.1-431s1c1
Sequence:CCGGGATTTCCAACCTTACTTCAAACTCGAGTTTGAAGTAAGGTTGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027464.1-1074s1c1
Sequence:CCGGCGGTATTTGAAGTGAAGTTTACTCGAGTAAACTTCACTTCAAATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027464.1-954s1c1
Sequence:CCGGCCCAGACAGAACAGAGTTCAACTCGAGTTGAACTCTGTTCTGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027464.1-349s1c1
Sequence:CCGGGATGTCCTTGAAGCCCAAGTTCTCGAGAACTTGGGCTTCAAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198479    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027464.1-1072s1c1
Sequence:CCGGGCCGGTATTTGAAGTGAAGTTCTCGAGAACTTCACTTCAAATACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027464.3-1073s21c1
Sequence:CCGGCGGTATTTGAAGTGAAGTTTACTCGAGTAAACTTCACTTCAAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027464.3-953s21c1
Sequence:CCGGCCCAGACAGAACAGAGTTCAACTCGAGTTGAACTCTGTTCTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027464.3-430s21c1
Sequence:CCGGGATTTCCAACCTTACTTCAAACTCGAGTTTGAAGTAAGGTTGGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027464.3-495s21c1
Sequence:CCGGGAGGCGGAAGATGATGTTCATCTCGAGATGAACATCATCTTCCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027464
VALIDATED
FAM213A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 213, member A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027464.1-496s1c1
Sequence:CCGGGAGGCGGAAGATGATGTTCATCTCGAGATGAACATCATCTTCCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027464.1-431s1c1
Sequence:CCGGGATTTCCAACCTTACTTCAAACTCGAGTTTGAAGTAAGGTTGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027464.1-1074s1c1
Sequence:CCGGCGGTATTTGAAGTGAAGTTTACTCGAGTAAACTTCACTTCAAATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027464.1-954s1c1
Sequence:CCGGCCCAGACAGAACAGAGTTCAACTCGAGTTGAACTCTGTTCTGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027464.1-349s1c1
Sequence:CCGGGATGTCCTTGAAGCCCAAGTTCTCGAGAACTTGGGCTTCAAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198479    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027464.1-1072s1c1
Sequence:CCGGGCCGGTATTTGAAGTGAAGTTCTCGAGAACTTCACTTCAAATACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027464.3-1073s21c1
Sequence:CCGGCGGTATTTGAAGTGAAGTTTACTCGAGTAAACTTCACTTCAAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027464.3-953s21c1
Sequence:CCGGCCCAGACAGAACAGAGTTCAACTCGAGTTGAACTCTGTTCTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027464.3-430s21c1
Sequence:CCGGGATTTCCAACCTTACTTCAAACTCGAGTTTGAAGTAAGGTTGGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027464.3-495s21c1
Sequence:CCGGGAGGCGGAAGATGATGTTCATCTCGAGATGAACATCATCTTCCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks