EMAIL THIS PAGE TO A FRIEND

FAM213B

family with sequence similarity 213, member B

Synonyms: C1orf93
Gene ID:
Mouse(66469) family with sequence similarity 213, member B
Rat(362676) family with sequence similarity 213, member B
Zebrafish(406605) family with sequence similarity 213, member B
cow(617001) chromosome 16 open reading frame, human C1orf93
domestic cat(101090122) family with sequence similarity 213, member B
dog(489616) family with sequence similarity 213, member B
naked mole-rat(101722975) family with sequence similarity 213, member B
domestic guinea pig(100733270) family with sequence similarity 213, member B
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152371 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152371 Rosetta Predictions human pricing
NM_001108697 Rosetta Predictions rat pricing
NM_025582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086410 predicted 796
2 SASI_Hs01_00086411 predicted 383
3 SASI_Hs01_00086412 predicted 523
4 SASI_Hs01_00086413 predicted 326
5 SASI_Hs01_00086414 predicted 372
6 SASI_Hs01_00086415 predicted 531
7 SASI_Hs01_00086416 predicted 720
8 SASI_Hs01_00086417 predicted 652
9 SASI_Hs01_00086418 predicted 386
10 SASI_Hs01_00086419 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108697 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241185 predicted 438
2 SASI_Rn02_00241186 predicted 335
3 SASI_Rn02_00241187 predicted 301
4 SASI_Rn02_00241188 predicted 458
5 SASI_Rn02_00241189 predicted 365
6 SASI_Rn02_00241190 predicted 427
7 SASI_Rn02_00241191 predicted 307
8 SASI_Rn02_00241192 predicted 412
9 SASI_Rn02_00241193 predicted 291
10 SASI_Rn02_00241194 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140039 predicted 315
2 SASI_Mm01_00140040 predicted 351
3 SASI_Mm01_00140041 predicted 436
4 SASI_Mm01_00140042 predicted 280
5 SASI_Mm01_00140043 predicted 407
6 SASI_Mm01_00140044 predicted 494
7 SASI_Mm01_00140045 predicted 412
8 SASI_Mm01_00140046 predicted 275
9 SASI_Mm01_00140047 predicted 342
10 SASI_Mm01_00140048 predicted 269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152371
FAM213B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 213, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152371.2-382s21c1
Sequence:CCGGGCTAGGCTTCAAGCGGTACAACTCGAGTTGTACCGCTTGAAGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152371.2-528s21c1
Sequence:CCGGTCAGCAAAGGTGGTGATAAAGCTCGAGCTTTATCACCACCTTTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152371.2-355s21c1
Sequence:CCGGGGATGAGAGCAAGCAGCTTTACTCGAGTAAAGCTGCTTGCTCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152371.2-550s21c1
Sequence:CCGGGCTCCTGCATTTCGTCCAGAACTCGAGTTCTGGACGAAATGCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152371.2-1285s21c1
Sequence:CCGGCCGGGAGGGTCTTAGTCTAATCTCGAGATTAGACTAAGACCCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152371.1-361s1c1
Sequence:CCGGGAGCAAGCAGCTTTACAAGGACTCGAGTCCTTGTAAAGCTGCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152371.1-370s1c1
Sequence:CCGGGCTTTACAAGGAGCTAGGCTTCTCGAGAAGCCTAGCTCCTTGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152371.1-2459s1c1
Sequence:CCGGGAAACATTTCAACCATGAGATCTCGAGATCTCATGGTTGAAATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152371
FAM213B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 213, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152371.2-382s21c1
Sequence:CCGGGCTAGGCTTCAAGCGGTACAACTCGAGTTGTACCGCTTGAAGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152371.2-528s21c1
Sequence:CCGGTCAGCAAAGGTGGTGATAAAGCTCGAGCTTTATCACCACCTTTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152371.2-355s21c1
Sequence:CCGGGGATGAGAGCAAGCAGCTTTACTCGAGTAAAGCTGCTTGCTCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152371.2-550s21c1
Sequence:CCGGGCTCCTGCATTTCGTCCAGAACTCGAGTTCTGGACGAAATGCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152371.2-1285s21c1
Sequence:CCGGCCGGGAGGGTCTTAGTCTAATCTCGAGATTAGACTAAGACCCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152371.1-361s1c1
Sequence:CCGGGAGCAAGCAGCTTTACAAGGACTCGAGTCCTTGTAAAGCTGCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152371.1-370s1c1
Sequence:CCGGGCTTTACAAGGAGCTAGGCTTCTCGAGAAGCCTAGCTCCTTGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152371.1-2459s1c1
Sequence:CCGGGAAACATTTCAACCATGAGATCTCGAGATCTCATGGTTGAAATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152371
FAM213B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 213, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152371.2-382s21c1
Sequence:CCGGGCTAGGCTTCAAGCGGTACAACTCGAGTTGTACCGCTTGAAGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152371.2-528s21c1
Sequence:CCGGTCAGCAAAGGTGGTGATAAAGCTCGAGCTTTATCACCACCTTTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152371.2-355s21c1
Sequence:CCGGGGATGAGAGCAAGCAGCTTTACTCGAGTAAAGCTGCTTGCTCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152371.2-550s21c1
Sequence:CCGGGCTCCTGCATTTCGTCCAGAACTCGAGTTCTGGACGAAATGCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152371.2-1285s21c1
Sequence:CCGGCCGGGAGGGTCTTAGTCTAATCTCGAGATTAGACTAAGACCCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152371.1-361s1c1
Sequence:CCGGGAGCAAGCAGCTTTACAAGGACTCGAGTCCTTGTAAAGCTGCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152371.1-370s1c1
Sequence:CCGGGCTTTACAAGGAGCTAGGCTTCTCGAGAAGCCTAGCTCCTTGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152371.1-2459s1c1
Sequence:CCGGGAAACATTTCAACCATGAGATCTCGAGATCTCATGGTTGAAATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025582
FAM213B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 213, member B
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025582.2-357s1c1
Sequence:CCGGGCGGTACAACAGCTTAAGCATCTCGAGATGCTTAAGCTGTTGTACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025582.2-70s1c1
Sequence:CCGGGCGTGTGTCTTGAAACATGCACTCGAGTGCATGTTTCAAGACACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025582.2-409s1c1
Sequence:CCGGGATGTAGCCTCCAAGGCTAAACTCGAGTTTAGCCTTGGAGGCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025582.2-279s1c1
Sequence:CCGGGTTTCTGGATGGTGGTTACTTCTCGAGAAGTAACCACCATCCAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025582.2-420s1c1
Sequence:CCGGCAAGGCTAAAGCTGTTGGTATCTCGAGATACCAACAGCTTTAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025582.2-504s1c1
Sequence:CCGGCGACAAGGTACTGTTGCACTTCTCGAGAAGTGCAACAGTACCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025582
FAM213B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 213, member B
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025582.2-357s1c1
Sequence:CCGGGCGGTACAACAGCTTAAGCATCTCGAGATGCTTAAGCTGTTGTACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025582.2-70s1c1
Sequence:CCGGGCGTGTGTCTTGAAACATGCACTCGAGTGCATGTTTCAAGACACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025582.2-409s1c1
Sequence:CCGGGATGTAGCCTCCAAGGCTAAACTCGAGTTTAGCCTTGGAGGCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025582.2-279s1c1
Sequence:CCGGGTTTCTGGATGGTGGTTACTTCTCGAGAAGTAACCACCATCCAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025582.2-420s1c1
Sequence:CCGGCAAGGCTAAAGCTGTTGGTATCTCGAGATACCAACAGCTTTAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025582.2-504s1c1
Sequence:CCGGCGACAAGGTACTGTTGCACTTCTCGAGAAGTGCAACAGTACCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025582
FAM213B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 213, member B
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025582.2-357s1c1
Sequence:CCGGGCGGTACAACAGCTTAAGCATCTCGAGATGCTTAAGCTGTTGTACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025582.2-70s1c1
Sequence:CCGGGCGTGTGTCTTGAAACATGCACTCGAGTGCATGTTTCAAGACACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025582.2-409s1c1
Sequence:CCGGGATGTAGCCTCCAAGGCTAAACTCGAGTTTAGCCTTGGAGGCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025582.2-279s1c1
Sequence:CCGGGTTTCTGGATGGTGGTTACTTCTCGAGAAGTAACCACCATCCAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025582.2-420s1c1
Sequence:CCGGCAAGGCTAAAGCTGTTGGTATCTCGAGATACCAACAGCTTTAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025582.2-504s1c1
Sequence:CCGGCGACAAGGTACTGTTGCACTTCTCGAGAAGTGCAACAGTACCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks