EMAIL THIS PAGE TO A FRIEND

FAM214A

family with sequence similarity 214, member A

112 Gene Product Result for
Synonyms: KIAA1370
Gene ID:
Mouse(235493) family with sequence similarity 214, member A
Rat(300836) family with sequence similarity 214, member A
sheep(101102648) family with sequence similarity 214, member A
domestic guinea pig(100719883) family with sequence similarity 214, member A
naked mole-rat(101726666) family with sequence similarity 214, member A
Zebrafish(555595) family with sequence similarity 214, member A
domestic cat(101080796) family with sequence similarity 214, member A
chicken(415416) family with sequence similarity 214, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153584 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153584 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153584 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019600 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019600 Rosetta Predictions human pricing
NM_001106838 Rosetta Predictions rat pricing
NM_001113283 Rosetta Predictions mouse pricing
NM_153584 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146623 predicted 3018
2 SASI_Hs02_00352802 predicted 1286
3 SASI_Hs01_00146624 predicted 2512
4 SASI_Hs02_00352803 predicted 900
5 SASI_Hs01_00146626 predicted 1637
6 SASI_Hs01_00146627 predicted 836
7 SASI_Hs01_00146628 predicted 498
8 SASI_Hs01_00146629 predicted 2815
9 SASI_Hs01_00146630 predicted 1109
10 SASI_Hs01_00146631 predicted 2493
11 SASI_Hs01_00146622 predicted 1270
12 SASI_Hs01_00146625 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222904 predicted 3161
2 SASI_Rn02_00222905 predicted 3511
3 SASI_Rn02_00222906 predicted 3066
4 SASI_Rn02_00222907 predicted 3519
5 SASI_Rn02_00222908 predicted 997
6 SASI_Rn02_00222909 predicted 2522
7 SASI_Rn02_00222910 predicted 561
8 SASI_Rn02_00222911 predicted 3479
9 SASI_Rn02_00222912 predicted 631
10 SASI_Rn02_00222913 predicted 3396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113283 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307323 predicted 1415
2 SASI_Mm02_00307324 predicted 3087
3 SASI_Mm02_00307325 predicted 3327
4 SASI_Mm02_00307326 predicted 1789
5 SASI_Mm02_00307327 predicted 1012
6 SASI_Mm02_00307328 predicted 1689
7 SASI_Mm02_00307329 predicted 967
8 SASI_Mm02_00307330 predicted 3417
9 SASI_Mm02_00307331 predicted 2550
10 SASI_Mm02_00307332 predicted 1746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148835 predicted 1242
2 SASI_Mm01_00148836 predicted 2912
3 SASI_Mm01_00148837 predicted 3143
4 SASI_Mm01_00148838 predicted 1613
5 SASI_Mm01_00148840 predicted 840
6 SASI_Mm01_00148841 predicted 1511
7 SASI_Mm02_00343399 predicted 785
8 SASI_Mm01_00148843 predicted 3247
9 SASI_Mm01_00148844 predicted 2375
10 SASI_Mm02_00343400 predicted 1564
11 SASI_Mm01_00148839 predicted 1832
12 SASI_Mm01_00148842 predicted 324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153584
VALIDATED
FAM214A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 214, member A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183469    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153584.1-3578s1c1
Sequence:CCGGGTACTGTTGAAACCACTTCATCTCGAGATGAAGTGGTTTCAACAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153584.1-2238s1c1
Sequence:CCGGGCTGGAAATGCCTGACAGTTTCTCGAGAAACTGTCAGGCATTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153584.2-1145s21c1
Sequence:CCGGCGTCAGTGAGAACGTTCAAATCTCGAGATTTGAACGTTCTCACTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153584.2-2919s1c1
Sequence:CCGGCTACAGTGTTTCCGATGATAACTCGAGTTATCATCGGAAACACTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153584.2-1819s1c1
Sequence:CCGGGAAAGCCTCAAACCTAGTAAACTCGAGTTTACTAGGTTTGAGGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153584.2-484s21c1
Sequence:CCGGCTGAATGATCCCGCCATTAAGCTCGAGCTTAATGGCGGGATCATTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153584.2-2803s21c1
Sequence:CCGGTCGGTTCTGAACTACCGTTTACTCGAGTAAACGGTAGTTCAGAACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153584.2-165s21c1
Sequence:CCGGAGATGCCTTGGATGAGTATTTCTCGAGAAATACTCATCCAAGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153584.2-3855s21c1
Sequence:CCGGTTGGGCTTCTTTAAGATTAATCTCGAGATTAATCTTAAAGAAGCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153584
VALIDATED
FAM214A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 214, member A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183469    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153584.1-3578s1c1
Sequence:CCGGGTACTGTTGAAACCACTTCATCTCGAGATGAAGTGGTTTCAACAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153584.1-2238s1c1
Sequence:CCGGGCTGGAAATGCCTGACAGTTTCTCGAGAAACTGTCAGGCATTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153584.2-1145s21c1
Sequence:CCGGCGTCAGTGAGAACGTTCAAATCTCGAGATTTGAACGTTCTCACTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153584.2-2919s1c1
Sequence:CCGGCTACAGTGTTTCCGATGATAACTCGAGTTATCATCGGAAACACTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153584.2-1819s1c1
Sequence:CCGGGAAAGCCTCAAACCTAGTAAACTCGAGTTTACTAGGTTTGAGGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153584.2-484s21c1
Sequence:CCGGCTGAATGATCCCGCCATTAAGCTCGAGCTTAATGGCGGGATCATTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153584.2-2803s21c1
Sequence:CCGGTCGGTTCTGAACTACCGTTTACTCGAGTAAACGGTAGTTCAGAACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153584.2-165s21c1
Sequence:CCGGAGATGCCTTGGATGAGTATTTCTCGAGAAATACTCATCCAAGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153584.2-3855s21c1
Sequence:CCGGTTGGGCTTCTTTAAGATTAATCTCGAGATTAATCTTAAAGAAGCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153584
VALIDATED
FAM214A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 214, member A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183469    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153584.1-3578s1c1
Sequence:CCGGGTACTGTTGAAACCACTTCATCTCGAGATGAAGTGGTTTCAACAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153584.1-2238s1c1
Sequence:CCGGGCTGGAAATGCCTGACAGTTTCTCGAGAAACTGTCAGGCATTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153584.2-1145s21c1
Sequence:CCGGCGTCAGTGAGAACGTTCAAATCTCGAGATTTGAACGTTCTCACTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153584.2-2919s1c1
Sequence:CCGGCTACAGTGTTTCCGATGATAACTCGAGTTATCATCGGAAACACTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153584.2-1819s1c1
Sequence:CCGGGAAAGCCTCAAACCTAGTAAACTCGAGTTTACTAGGTTTGAGGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153584.2-484s21c1
Sequence:CCGGCTGAATGATCCCGCCATTAAGCTCGAGCTTAATGGCGGGATCATTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153584.2-2803s21c1
Sequence:CCGGTCGGTTCTGAACTACCGTTTACTCGAGTAAACGGTAGTTCAGAACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153584.2-165s21c1
Sequence:CCGGAGATGCCTTGGATGAGTATTTCTCGAGAAATACTCATCCAAGGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153584.2-3855s21c1
Sequence:CCGGTTGGGCTTCTTTAAGATTAATCTCGAGATTAATCTTAAAGAAGCCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019600
VALIDATED
FAM214A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 214, member A
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000172637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019600.1-287s1c1
Sequence:CCGGGCACAGTCTTGTTACCCAGTACTCGAGTACTGGGTAACAAGACTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019600.1-3191s1c1
Sequence:CCGGCGGTTATTACGCTACCTCATACTCGAGTATGAGGTAGCGTAATAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019600.1-1695s1c1
Sequence:CCGGCTAAAGTGTTTAGGAGTTCATCTCGAGATGAACTCCTAAACACTTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019600.1-233s1c1
Sequence:CCGGCGAACACCTGAATGTTCTGTACTCGAGTACAGAACATTCAGGTGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019600
VALIDATED
FAM214A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 214, member A
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000172637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019600.1-287s1c1
Sequence:CCGGGCACAGTCTTGTTACCCAGTACTCGAGTACTGGGTAACAAGACTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019600.1-3191s1c1
Sequence:CCGGCGGTTATTACGCTACCTCATACTCGAGTATGAGGTAGCGTAATAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019600.1-1695s1c1
Sequence:CCGGCTAAAGTGTTTAGGAGTTCATCTCGAGATGAACTCCTAAACACTTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019600.1-233s1c1
Sequence:CCGGCGAACACCTGAATGTTCTGTACTCGAGTACAGAACATTCAGGTGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019600
VALIDATED
FAM214A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 214, member A
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000172637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019600.1-287s1c1
Sequence:CCGGGCACAGTCTTGTTACCCAGTACTCGAGTACTGGGTAACAAGACTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019600.1-3191s1c1
Sequence:CCGGCGGTTATTACGCTACCTCATACTCGAGTATGAGGTAGCGTAATAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019600.1-1695s1c1
Sequence:CCGGCTAAAGTGTTTAGGAGTTCATCTCGAGATGAACTCCTAAACACTTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019600.1-233s1c1
Sequence:CCGGCGAACACCTGAATGTTCTGTACTCGAGTACAGAACATTCAGGTGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)