EMAIL THIS PAGE TO A FRIEND

FAM214B

family with sequence similarity 214, member B

137 Gene Product Result for
Synonyms: KIAA1539 P1.11659_5 RP11-182N22.6 bA182N22.6
Gene ID:
Mouse(230088) family with sequence similarity 214, member B
Rat(298201) family with sequence similarity 214, member B
Zebrafish(556829) family with sequence similarity 214, member B
cow(510325) KIAA1539 ortholog
domestic cat(101089152) family with sequence similarity 214, member B
chicken(100858763) family with sequence similarity 214, member B
naked mole-rat(101716169) family with sequence similarity 214, member B
domestic guinea pig(100728809) family with sequence similarity 214, member B
sheep(101117991) family with sequence similarity 214, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025182 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172691 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172691 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172691 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025182 Rosetta Predictions human pricing
NM_001013931 Rosetta Predictions rat pricing
NM_172691 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212860 predicted 1787
2 SASI_Hs01_00212861 predicted 2007
3 SASI_Hs01_00212862 predicted 1915
4 SASI_Hs02_00357939 predicted 1478
5 SASI_Hs02_00357940 predicted 1478
6 SASI_Hs01_00212863 predicted 1808
7 SASI_Hs01_00212865 predicted 1970
8 SASI_Hs01_00212866 predicted 1583
9 SASI_Hs02_00357941 predicted 1921
10 SASI_Hs01_00212868 predicted 1624
11 SASI_Hs01_00212864 predicted 1127
12 SASI_Hs01_00212867 predicted 1664
13 SASI_Hs01_00212869 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013931 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071618 predicted 646
2 SASI_Rn01_00071619 predicted 728
3 SASI_Rn02_00201231 predicted 1535
4 SASI_Rn01_00071620 predicted 1080
5 SASI_Rn01_00071621 predicted 1571
6 SASI_Rn01_00071622 predicted 1890
7 SASI_Rn01_00071623 predicted 547
8 SASI_Rn01_00071624 predicted 1209
9 SASI_Rn01_00071625 predicted 1870
10 SASI_Rn01_00071626 predicted 1743
11 SASI_Rn01_00071627 predicted 1609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135444 predicted 698
2 SASI_Mm01_00135445 predicted 1800
3 SASI_Mm01_00135446 predicted 1587
4 SASI_Mm01_00135447 predicted 1945
5 SASI_Mm01_00135448 predicted 1133
6 SASI_Mm01_00135449 predicted 1624
7 SASI_Mm02_00344436 predicted 1135
8 SASI_Mm01_00135450 predicted 1267
9 SASI_Mm02_00344437 predicted 1588
10 SASI_Mm01_00135452 predicted 1587
11 SASI_Mm01_00135443 predicted 789
12 SASI_Mm01_00135451 predicted 1402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025182
FAM214B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 214, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025182.2-1895s21c1
Sequence:CCGGCCCTCATAATCCACGTTATTCCTCGAGGAATAACGTGGATTATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025182.2-1939s21c1
Sequence:CCGGTCTGAACCCATGCGGGCTAATCTCGAGATTAGCCCGCATGGGTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025182.2-2047s21c1
Sequence:CCGGTCACGCCCAAATGGATTATTTCTCGAGAAATAATCCATTTGGGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025182.2-1613s1c1
Sequence:CCGGCAACCAGACTGTGGTAAAGATCTCGAGATCTTTACCACAGTCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025182.2-754s1c1
Sequence:CCGGCAAATGCTTCCTGCAATACTTCTCGAGAAGTATTGCAGGAAGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025182.2-750s1c1
Sequence:CCGGCCATCAAATGCTTCCTGCAATCTCGAGATTGCAGGAAGCATTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025182.2-860s1c1
Sequence:CCGGGCACACACTTGACACTGATTTCTCGAGAAATCAGTGTCAAGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025182.2-1974s1c1
Sequence:CCGGGCTCCATCTTAGAGAACATATCTCGAGATATGTTCTCTAAGATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025182
FAM214B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 214, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025182.2-1895s21c1
Sequence:CCGGCCCTCATAATCCACGTTATTCCTCGAGGAATAACGTGGATTATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025182.2-1939s21c1
Sequence:CCGGTCTGAACCCATGCGGGCTAATCTCGAGATTAGCCCGCATGGGTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025182.2-2047s21c1
Sequence:CCGGTCACGCCCAAATGGATTATTTCTCGAGAAATAATCCATTTGGGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025182.2-1613s1c1
Sequence:CCGGCAACCAGACTGTGGTAAAGATCTCGAGATCTTTACCACAGTCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025182.2-754s1c1
Sequence:CCGGCAAATGCTTCCTGCAATACTTCTCGAGAAGTATTGCAGGAAGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025182.2-750s1c1
Sequence:CCGGCCATCAAATGCTTCCTGCAATCTCGAGATTGCAGGAAGCATTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025182.2-860s1c1
Sequence:CCGGGCACACACTTGACACTGATTTCTCGAGAAATCAGTGTCAAGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025182.2-1974s1c1
Sequence:CCGGGCTCCATCTTAGAGAACATATCTCGAGATATGTTCTCTAAGATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025182
FAM214B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 214, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025182.2-1895s21c1
Sequence:CCGGCCCTCATAATCCACGTTATTCCTCGAGGAATAACGTGGATTATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025182.2-1939s21c1
Sequence:CCGGTCTGAACCCATGCGGGCTAATCTCGAGATTAGCCCGCATGGGTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025182.2-2047s21c1
Sequence:CCGGTCACGCCCAAATGGATTATTTCTCGAGAAATAATCCATTTGGGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025182.2-1613s1c1
Sequence:CCGGCAACCAGACTGTGGTAAAGATCTCGAGATCTTTACCACAGTCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025182.2-754s1c1
Sequence:CCGGCAAATGCTTCCTGCAATACTTCTCGAGAAGTATTGCAGGAAGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025182.2-750s1c1
Sequence:CCGGCCATCAAATGCTTCCTGCAATCTCGAGATTGCAGGAAGCATTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025182.2-860s1c1
Sequence:CCGGGCACACACTTGACACTGATTTCTCGAGAAATCAGTGTCAAGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025182.2-1974s1c1
Sequence:CCGGGCTCCATCTTAGAGAACATATCTCGAGATATGTTCTCTAAGATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172691
FAM214B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 214, member B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172691.2-2056s21c1
Sequence:CCGGTCACGCCCAAATTGACTATTTCTCGAGAAATAGTCAATTTGGGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172691.2-1439s21c1
Sequence:CCGGATTGGAGCCAGTGGGTCTTACCTCGAGGTAAGACCCACTGGCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172691.2-693s21c1
Sequence:CCGGTTGTGGAGCACGGAGGTAATACTCGAGTATTACCTCCGTGCTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172691.2-1596s21c1
Sequence:CCGGCCATCCAAGTGACCTTATTTACTCGAGTAAATAAGGTCACTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172691.2-746s21c1
Sequence:CCGGACACCCTGGCTCTCATCAAATCTCGAGATTTGATGAGAGCCAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172691.1-885s1c1
Sequence:CCGGGATTTGCACAATCTTGCACAACTCGAGTTGTGCAAGATTGTGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172691.1-1594s1c1
Sequence:CCGGGCACCATCCAAGTGACCTTATCTCGAGATAAGGTCACTTGGATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172691.1-1597s1c1
Sequence:CCGGCCATCCAAGTGACCTTATTTACTCGAGTAAATAAGGTCACTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172691
FAM214B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 214, member B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172691.2-2056s21c1
Sequence:CCGGTCACGCCCAAATTGACTATTTCTCGAGAAATAGTCAATTTGGGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172691.2-1439s21c1
Sequence:CCGGATTGGAGCCAGTGGGTCTTACCTCGAGGTAAGACCCACTGGCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172691.2-693s21c1
Sequence:CCGGTTGTGGAGCACGGAGGTAATACTCGAGTATTACCTCCGTGCTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172691.2-1596s21c1
Sequence:CCGGCCATCCAAGTGACCTTATTTACTCGAGTAAATAAGGTCACTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172691.2-746s21c1
Sequence:CCGGACACCCTGGCTCTCATCAAATCTCGAGATTTGATGAGAGCCAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172691.1-885s1c1
Sequence:CCGGGATTTGCACAATCTTGCACAACTCGAGTTGTGCAAGATTGTGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172691.1-1594s1c1
Sequence:CCGGGCACCATCCAAGTGACCTTATCTCGAGATAAGGTCACTTGGATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172691.1-1597s1c1
Sequence:CCGGCCATCCAAGTGACCTTATTTACTCGAGTAAATAAGGTCACTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172691
FAM214B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 214, member B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172691.2-2056s21c1
Sequence:CCGGTCACGCCCAAATTGACTATTTCTCGAGAAATAGTCAATTTGGGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172691.2-1439s21c1
Sequence:CCGGATTGGAGCCAGTGGGTCTTACCTCGAGGTAAGACCCACTGGCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172691.2-693s21c1
Sequence:CCGGTTGTGGAGCACGGAGGTAATACTCGAGTATTACCTCCGTGCTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172691.2-1596s21c1
Sequence:CCGGCCATCCAAGTGACCTTATTTACTCGAGTAAATAAGGTCACTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172691.2-746s21c1
Sequence:CCGGACACCCTGGCTCTCATCAAATCTCGAGATTTGATGAGAGCCAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172691.1-885s1c1
Sequence:CCGGGATTTGCACAATCTTGCACAACTCGAGTTGTGCAAGATTGTGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172691.1-1594s1c1
Sequence:CCGGGCACCATCCAAGTGACCTTATCTCGAGATAAGGTCACTTGGATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172691.1-1597s1c1
Sequence:CCGGCCATCCAAGTGACCTTATTTACTCGAGTAAATAAGGTCACTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks