EMAIL THIS PAGE TO A FRIEND

FAM216A

family with sequence similarity 216, member A

57 Gene Product Result for
Synonyms: C12orf24 HSU79274
UniProtKB ID: Q8WUB2, A6NH30, Q99776
Gene ID:
Mouse(68948) family with sequence similarity 216, member A
Rat(288667) family with sequence similarity 216, member A
cow(616613) chromosome 17 open reading frame, human C12orf24
domestic cat(101099331) family with sequence similarity 216, member A
sheep(101104529) family with sequence similarity 216, member A
domestic guinea pig(100717431) family with sequence similarity 216, member A
naked mole-rat(101718646) family with sequence similarity 216, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013300 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013300 Rosetta Predictions human pricing
NM_001008290 Rosetta Predictions rat pricing
NM_026883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124756 predicted 581
2 SASI_Hs01_00124757 predicted 591
3 SASI_Hs01_00124758 predicted 837
4 SASI_Hs01_00124759 predicted 587
5 SASI_Hs02_00344578 predicted 640
6 SASI_Hs01_00124760 predicted 1009
7 SASI_Hs01_00124762 predicted 929
8 SASI_Hs02_00344579 predicted 597
9 SASI_Hs01_00124764 predicted 838
10 SASI_Hs01_00124765 predicted 905
11 SASI_Hs01_00124761 predicted 670
12 SASI_Hs01_00124763 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070966 predicted 791
2 SASI_Rn01_00070967 predicted 657
3 SASI_Rn01_00070968 predicted 431
4 SASI_Rn01_00070969 predicted 443
5 SASI_Rn01_00070971 predicted 571
6 SASI_Rn02_00198993 predicted 444
7 SASI_Rn01_00070972 predicted 338
8 SASI_Rn02_00198994 predicted 878
9 SASI_Rn01_00070973 predicted 949
10 SASI_Rn01_00070974 predicted 454
11 SASI_Rn01_00070970 predicted 522
12 SASI_Rn01_00070975 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200741 predicted 698
2 SASI_Mm01_00200742 predicted 319
3 SASI_Mm01_00200744 predicted 639
4 SASI_Mm01_00200745 predicted 412
5 SASI_Mm01_00200746 predicted 295
6 SASI_Mm02_00331138 predicted 658
7 SASI_Mm01_00200747 predicted 210
8 SASI_Mm01_00200748 predicted 360
9 SASI_Mm01_00200749 predicted 619
10 SASI_Mm02_00331139 predicted 427
11 SASI_Mm01_00200740 predicted 547
12 SASI_Mm01_00200743 predicted 778
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013300
VALIDATED
FAM216A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 216, member A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013300.1-1300s1c1
Sequence:CCGGCCTGTATGTTTAGGATGGTATCTCGAGATACCATCCTAAACATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013300.1-1213s1c1
Sequence:CCGGAGGGAGAACATCTGATGTTAACTCGAGTTAACATCAGATGTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013300.1-797s1c1
Sequence:CCGGGATGTTAATGAAGAGGCAGTACTCGAGTACTGCCTCTTCATTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013300.1-566s1c1
Sequence:CCGGTGGATACTCTTGTTACCAGAACTCGAGTTCTGGTAACAAGAGTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013300.1-568s1c1
Sequence:CCGGGATACTCTTGTTACCAGAATTCTCGAGAATTCTGGTAACAAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013300.2-670s21c1
Sequence:CCGGTAGCTAAGCTGCAAGAGTTATCTCGAGATAACTCTTGCAGCTTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013300.2-601s21c1
Sequence:CCGGGATACTCTTGTTACCAGAATTCTCGAGAATTCTGGTAACAAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013300.2-830s21c1
Sequence:CCGGGATGTTAATGAAGAGGCAGTACTCGAGTACTGCCTCTTCATTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013300.2-1246s21c1
Sequence:CCGGAGGGAGAACATCTGATGTTAACTCGAGTTAACATCAGATGTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013300.2-1295s21c1
Sequence:CCGGTCGTGCCAAAGGTGAGGGTAACTCGAGTTACCCTCACCTTTGGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013300.2-1270s21c1
Sequence:CCGGGACAGTCTTGTCTCGTGTATTCTCGAGAATACACGAGACAAGACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013300
VALIDATED
FAM216A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 216, member A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013300.1-1300s1c1
Sequence:CCGGCCTGTATGTTTAGGATGGTATCTCGAGATACCATCCTAAACATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013300.1-1213s1c1
Sequence:CCGGAGGGAGAACATCTGATGTTAACTCGAGTTAACATCAGATGTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013300.1-797s1c1
Sequence:CCGGGATGTTAATGAAGAGGCAGTACTCGAGTACTGCCTCTTCATTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013300.1-566s1c1
Sequence:CCGGTGGATACTCTTGTTACCAGAACTCGAGTTCTGGTAACAAGAGTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013300.1-568s1c1
Sequence:CCGGGATACTCTTGTTACCAGAATTCTCGAGAATTCTGGTAACAAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013300.2-670s21c1
Sequence:CCGGTAGCTAAGCTGCAAGAGTTATCTCGAGATAACTCTTGCAGCTTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013300.2-601s21c1
Sequence:CCGGGATACTCTTGTTACCAGAATTCTCGAGAATTCTGGTAACAAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013300.2-830s21c1
Sequence:CCGGGATGTTAATGAAGAGGCAGTACTCGAGTACTGCCTCTTCATTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013300.2-1246s21c1
Sequence:CCGGAGGGAGAACATCTGATGTTAACTCGAGTTAACATCAGATGTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013300.2-1295s21c1
Sequence:CCGGTCGTGCCAAAGGTGAGGGTAACTCGAGTTACCCTCACCTTTGGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013300.2-1270s21c1
Sequence:CCGGGACAGTCTTGTCTCGTGTATTCTCGAGAATACACGAGACAAGACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013300
VALIDATED
FAM216A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 216, member A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013300.1-1300s1c1
Sequence:CCGGCCTGTATGTTTAGGATGGTATCTCGAGATACCATCCTAAACATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013300.1-1213s1c1
Sequence:CCGGAGGGAGAACATCTGATGTTAACTCGAGTTAACATCAGATGTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013300.1-797s1c1
Sequence:CCGGGATGTTAATGAAGAGGCAGTACTCGAGTACTGCCTCTTCATTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013300.1-566s1c1
Sequence:CCGGTGGATACTCTTGTTACCAGAACTCGAGTTCTGGTAACAAGAGTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013300.1-568s1c1
Sequence:CCGGGATACTCTTGTTACCAGAATTCTCGAGAATTCTGGTAACAAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013300.2-670s21c1
Sequence:CCGGTAGCTAAGCTGCAAGAGTTATCTCGAGATAACTCTTGCAGCTTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013300.2-601s21c1
Sequence:CCGGGATACTCTTGTTACCAGAATTCTCGAGAATTCTGGTAACAAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013300.2-830s21c1
Sequence:CCGGGATGTTAATGAAGAGGCAGTACTCGAGTACTGCCTCTTCATTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013300.2-1246s21c1
Sequence:CCGGAGGGAGAACATCTGATGTTAACTCGAGTTAACATCAGATGTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013300.2-1295s21c1
Sequence:CCGGTCGTGCCAAAGGTGAGGGTAACTCGAGTTACCCTCACCTTTGGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013300.2-1270s21c1
Sequence:CCGGGACAGTCTTGTCTCGTGTATTCTCGAGAATACACGAGACAAGACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026883
VALIDATED
FAM216A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 216, member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201820    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026883.1-1190s1c1
Sequence:CCGGGCTAACATCCACATGCTGAGTCTCGAGACTCAGCATGTGGATGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190839    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026883.1-1221s1c1
Sequence:CCGGGAGTGGACCATGTATGGGATACTCGAGTATCCCATACATGGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026883.3-80s21c1
Sequence:CCGGGGATCAGCTGGACATTCTTATCTCGAGATAAGAATGTCCAGCTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026883.3-80s1c1
Sequence:CCGGGGATCAGCTGGACATTCTTATCTCGAGATAAGAATGTCCAGCTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026883.3-510s21c1
Sequence:CCGGGAGCACCTGAAATGATCATACCTCGAGGTATGATCATTTCAGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026883.3-215s21c1
Sequence:CCGGCAAACAATTCATATCCCTAAACTCGAGTTTAGGGATATGAATTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026883.3-832s21c1
Sequence:CCGGTGGACCATGTATGGGATAGTACTCGAGTACTATCCCATACATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026883.3-351s21c1
Sequence:CCGGGGCAGTACATGCACATATTTCCTCGAGGAAATATGTGCATGTACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026883
VALIDATED
FAM216A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 216, member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201820    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026883.1-1190s1c1
Sequence:CCGGGCTAACATCCACATGCTGAGTCTCGAGACTCAGCATGTGGATGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190839    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026883.1-1221s1c1
Sequence:CCGGGAGTGGACCATGTATGGGATACTCGAGTATCCCATACATGGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026883.3-80s21c1
Sequence:CCGGGGATCAGCTGGACATTCTTATCTCGAGATAAGAATGTCCAGCTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026883.3-80s1c1
Sequence:CCGGGGATCAGCTGGACATTCTTATCTCGAGATAAGAATGTCCAGCTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026883.3-510s21c1
Sequence:CCGGGAGCACCTGAAATGATCATACCTCGAGGTATGATCATTTCAGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026883.3-215s21c1
Sequence:CCGGCAAACAATTCATATCCCTAAACTCGAGTTTAGGGATATGAATTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026883.3-832s21c1
Sequence:CCGGTGGACCATGTATGGGATAGTACTCGAGTACTATCCCATACATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026883.3-351s21c1
Sequence:CCGGGGCAGTACATGCACATATTTCCTCGAGGAAATATGTGCATGTACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026883
VALIDATED
FAM216A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 216, member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201820    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026883.1-1190s1c1
Sequence:CCGGGCTAACATCCACATGCTGAGTCTCGAGACTCAGCATGTGGATGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190839    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026883.1-1221s1c1
Sequence:CCGGGAGTGGACCATGTATGGGATACTCGAGTATCCCATACATGGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026883.3-80s21c1
Sequence:CCGGGGATCAGCTGGACATTCTTATCTCGAGATAAGAATGTCCAGCTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026883.3-80s1c1
Sequence:CCGGGGATCAGCTGGACATTCTTATCTCGAGATAAGAATGTCCAGCTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026883.3-510s21c1
Sequence:CCGGGAGCACCTGAAATGATCATACCTCGAGGTATGATCATTTCAGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026883.3-215s21c1
Sequence:CCGGCAAACAATTCATATCCCTAAACTCGAGTTTAGGGATATGAATTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026883.3-832s21c1
Sequence:CCGGTGGACCATGTATGGGATAGTACTCGAGTACTATCCCATACATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026883.3-351s21c1
Sequence:CCGGGGCAGTACATGCACATATTTCCTCGAGGAAATATGTGCATGTACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks