EMAIL THIS PAGE TO A FRIEND

FAM216B

family with sequence similarity 216, member B

116 Gene Product Result for
Synonyms: C13orf30
UniProtKB ID: Q8N7L0, B1ALI3
Gene ID:
Mouse(219170) family with sequence similarity 216, member B
naked mole-rat(101725994) family with sequence similarity 216, member B
domestic guinea pig(100732146) family with sequence similarity 216, member B
sheep(101109104) family with sequence similarity 216, member B
dog(100682941) family with sequence similarity 216, member B
domestic cat(101089826) family with sequence similarity 216, member B
cow(614187) chromosome 12 open reading frame, human C13orf30
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182508 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177629 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177629 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177629 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016341 MISSION® esiRNA esiRNA targeting human C13orf30 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182508 Rosetta Predictions human pricing
NM_177629 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020321 predicted 922
2 SASI_Hs02_00370577 predicted 805
3 SASI_Hs02_00370578 predicted 261
4 SASI_Hs02_00370579 predicted 265
5 SASI_Hs01_00020324 predicted 904
6 SASI_Hs01_00020326 predicted 882
7 SASI_Hs02_00370580 predicted 300
8 SASI_Hs02_00370581 predicted 964
9 SASI_Hs02_00370582 predicted 831
10 SASI_Hs01_00020322 predicted 685
11 SASI_Hs01_00020323 predicted 547
12 SASI_Hs01_00020325 predicted 534
13 SASI_Hs01_00020327 predicted 567
14 SASI_Hs01_00020328 predicted 315
15 SASI_Hs01_00020329 predicted 323
16 SASI_Hs01_00020330 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177629 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196087 predicted 623
2 SASI_Mm02_00347869 predicted 900
3 SASI_Mm01_00196088 predicted 691
4 SASI_Mm01_00196089 predicted 658
5 SASI_Mm01_00196090 predicted 536
6 SASI_Mm01_00196091 predicted 500
7 SASI_Mm01_00196092 predicted 563
8 SASI_Mm01_00196094 predicted 279
9 SASI_Mm02_00347870 predicted 518
10 SASI_Mm01_00196095 predicted 701
11 SASI_Mm01_00196093 predicted 647
12 SASI_Mm01_00196096 predicted 967
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182508
FAM216B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 216, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182508.2-714s21c1
Sequence:CCGGAGCAATGGAGCCGAGAGTAAGCTCGAGCTTACTCTCGGCTCCATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182508.2-253s21c1
Sequence:CCGGTACAGCATTATGAGGATTTACCTCGAGGTAAATCCTCATAATGCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182508.2-938s21c1
Sequence:CCGGCAGGATTAACACTGATCATAGCTCGAGCTATGATCAGTGTTAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182508.2-746s21c1
Sequence:CCGGACATAACATCCGTAGAGTAAACTCGAGTTTACTCTACGGATGTTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182508.1-305s1c1
Sequence:CCGGGCCTTGTCTTATGCTCTTGTACTCGAGTACAAGAGCATAAGACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168458    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182508.1-2760s1c1
Sequence:CCGGGCTGACTACAAGTTGGTCTATCTCGAGATAGACCAACTTGTAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182508.1-2027s1c1
Sequence:CCGGGCATAGGTATTTGCTGTGTAACTCGAGTTACACAGCAAATACCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182508.1-272s1c1
Sequence:CCGGCAACAGCTGCTTGGCTATATTCTCGAGAATATAGCCAAGCAGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182508.1-95s1c1
Sequence:CCGGCTTTGGAATGTTCCACAACTTCTCGAGAAGTTGTGGAACATTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182508
FAM216B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 216, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182508.2-714s21c1
Sequence:CCGGAGCAATGGAGCCGAGAGTAAGCTCGAGCTTACTCTCGGCTCCATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182508.2-253s21c1
Sequence:CCGGTACAGCATTATGAGGATTTACCTCGAGGTAAATCCTCATAATGCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182508.2-938s21c1
Sequence:CCGGCAGGATTAACACTGATCATAGCTCGAGCTATGATCAGTGTTAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182508.2-746s21c1
Sequence:CCGGACATAACATCCGTAGAGTAAACTCGAGTTTACTCTACGGATGTTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182508.1-305s1c1
Sequence:CCGGGCCTTGTCTTATGCTCTTGTACTCGAGTACAAGAGCATAAGACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168458    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182508.1-2760s1c1
Sequence:CCGGGCTGACTACAAGTTGGTCTATCTCGAGATAGACCAACTTGTAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182508.1-2027s1c1
Sequence:CCGGGCATAGGTATTTGCTGTGTAACTCGAGTTACACAGCAAATACCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182508.1-272s1c1
Sequence:CCGGCAACAGCTGCTTGGCTATATTCTCGAGAATATAGCCAAGCAGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182508.1-95s1c1
Sequence:CCGGCTTTGGAATGTTCCACAACTTCTCGAGAAGTTGTGGAACATTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182508
FAM216B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 216, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182508.2-714s21c1
Sequence:CCGGAGCAATGGAGCCGAGAGTAAGCTCGAGCTTACTCTCGGCTCCATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182508.2-253s21c1
Sequence:CCGGTACAGCATTATGAGGATTTACCTCGAGGTAAATCCTCATAATGCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182508.2-938s21c1
Sequence:CCGGCAGGATTAACACTGATCATAGCTCGAGCTATGATCAGTGTTAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182508.2-746s21c1
Sequence:CCGGACATAACATCCGTAGAGTAAACTCGAGTTTACTCTACGGATGTTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182508.1-305s1c1
Sequence:CCGGGCCTTGTCTTATGCTCTTGTACTCGAGTACAAGAGCATAAGACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168458    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182508.1-2760s1c1
Sequence:CCGGGCTGACTACAAGTTGGTCTATCTCGAGATAGACCAACTTGTAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182508.1-2027s1c1
Sequence:CCGGGCATAGGTATTTGCTGTGTAACTCGAGTTACACAGCAAATACCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182508.1-272s1c1
Sequence:CCGGCAACAGCTGCTTGGCTATATTCTCGAGAATATAGCCAAGCAGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182508.1-95s1c1
Sequence:CCGGCTTTGGAATGTTCCACAACTTCTCGAGAAGTTGTGGAACATTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177629
FAM216B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 216, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177629.2-407s1c1
Sequence:CCGGCAGAGTCTTCAGCCATGCAAACTCGAGTTTGCATGGCTGAAGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177629.2-381s1c1
Sequence:CCGGGTTGCTCCTCAAAGGACTATTCTCGAGAATAGTCCTTTGAGGAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177629.2-644s1c1
Sequence:CCGGCCACATAAATGCTGCCAATAACTCGAGTTATTGGCAGCATTTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177629.2-293s1c1
Sequence:CCGGCCAACAGCATCTGGGTTACATCTCGAGATGTAACCCAGATGCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177629.2-215s1c1
Sequence:CCGGGTACAGCATCATGAGGATTTACTCGAGTAAATCCTCATGATGCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177629
FAM216B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 216, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177629.2-407s1c1
Sequence:CCGGCAGAGTCTTCAGCCATGCAAACTCGAGTTTGCATGGCTGAAGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177629.2-381s1c1
Sequence:CCGGGTTGCTCCTCAAAGGACTATTCTCGAGAATAGTCCTTTGAGGAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177629.2-644s1c1
Sequence:CCGGCCACATAAATGCTGCCAATAACTCGAGTTATTGGCAGCATTTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177629.2-293s1c1
Sequence:CCGGCCAACAGCATCTGGGTTACATCTCGAGATGTAACCCAGATGCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177629.2-215s1c1
Sequence:CCGGGTACAGCATCATGAGGATTTACTCGAGTAAATCCTCATGATGCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177629
FAM216B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 216, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177629.2-407s1c1
Sequence:CCGGCAGAGTCTTCAGCCATGCAAACTCGAGTTTGCATGGCTGAAGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177629.2-381s1c1
Sequence:CCGGGTTGCTCCTCAAAGGACTATTCTCGAGAATAGTCCTTTGAGGAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177629.2-644s1c1
Sequence:CCGGCCACATAAATGCTGCCAATAACTCGAGTTATTGGCAGCATTTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177629.2-293s1c1
Sequence:CCGGCCAACAGCATCTGGGTTACATCTCGAGATGTAACCCAGATGCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177629.2-215s1c1
Sequence:CCGGGTACAGCATCATGAGGATTTACTCGAGTAAATCCTCATGATGCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks