EMAIL THIS PAGE TO A FRIEND

FAM217A

family with sequence similarity 217, member A

57 Gene Product Result for
Synonyms: C6orf146
UniProtKB ID: Q8IXS0, Q5JYK1
Gene ID:
Mouse(71864) family with sequence similarity 217, member A
Rat(498735) family with sequence similarity 217, member A
cow(617315) family with sequence similarity 217, member A
domestic cat(101084107) family with sequence similarity 217, member A
sheep(101121722) family with sequence similarity 217, member A
domestic guinea pig(100717181) family with sequence similarity 217, member A
naked mole-rat(101721819) family with sequence similarity 217, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173563 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173563 Rosetta Predictions human pricing
XM_001065485 Rosetta Predictions rat pricing
XM_574011 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167354 predicted 1900
2 SASI_Hs01_00167355 predicted 794
3 SASI_Hs01_00167356 predicted 1222
4 SASI_Hs02_00368390 predicted 659
5 SASI_Hs01_00167357 predicted 389
6 SASI_Hs01_00167358 predicted 1569
7 SASI_Hs02_00368391 predicted 1174
8 SASI_Hs01_00167359 predicted 342
9 SASI_Hs01_00167360 predicted 1607
10 SASI_Hs01_00167361 predicted 828
11 SASI_Hs01_00167353 predicted 584
12 SASI_Hs01_00167362 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065485 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314330 predicted 832
2 SASI_Rn02_00314331 predicted 1506
3 SASI_Rn02_00314332 predicted 897
4 SASI_Rn02_00314333 predicted 1413
5 SASI_Rn02_00314334 predicted 746
6 SASI_Rn02_00314335 predicted 1003
7 SASI_Rn02_00314336 predicted 1127
8 SASI_Rn02_00314337 predicted 1505
9 SASI_Rn02_00314338 predicted 998
10 SASI_Rn02_00314339 predicted 1493
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401220 predicted 718
2 SASI_Rn02_00401221 predicted 836
3 SASI_Rn02_00401222 predicted 954
4 SASI_Rn02_00401223 predicted 1013
5 SASI_Rn02_00401224 predicted 901
6 SASI_Rn02_00401225 predicted 1002
7 SASI_Rn02_00401226 predicted 961
8 SASI_Rn02_00401227 predicted 1084
9 SASI_Rn02_00401228 predicted 1110
10 SASI_Rn02_00401229 predicted 772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173563
FAM217A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 217, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-794s1c1
Sequence:CCGGCCCTATGCTGATGGAGACTTTCTCGAGAAAGTCTCCATCAGCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-1133s1c1
Sequence:CCGGGCCCTCTCCAAATCTGACAATCTCGAGATTGTCAGATTTGGAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-1056s1c1
Sequence:CCGGCCGAGGAGCCAAATGAAGTATCTCGAGATACTTCATTTGGCTCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163469    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173563.1-2020s1c1
Sequence:CCGGGCACTGCTGAGATGTCTATATCTCGAGATATAGACATCTCAGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161372    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173563.1-1914s1c1
Sequence:CCGGGCCCAACTAAGATATGGTTAACTCGAGTTAACCATATCTTAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-1580s1c1
Sequence:CCGGCTCTCATTCAAACCTACTATTCTCGAGAATAGTAGGTTTGAATGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-731s1c1
Sequence:CCGGGCTTCAGTTGATAAGCAAGTTCTCGAGAACTTGCTTATCAACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-536s1c1
Sequence:CCGGGAACCTAATTTGTCGGTGCATCTCGAGATGCACCGACAAATTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-523s1c1
Sequence:CCGGGCAACTGATGCTAGAACCTAACTCGAGTTAGGTTCTAGCATCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173563
FAM217A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 217, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-794s1c1
Sequence:CCGGCCCTATGCTGATGGAGACTTTCTCGAGAAAGTCTCCATCAGCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-1133s1c1
Sequence:CCGGGCCCTCTCCAAATCTGACAATCTCGAGATTGTCAGATTTGGAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-1056s1c1
Sequence:CCGGCCGAGGAGCCAAATGAAGTATCTCGAGATACTTCATTTGGCTCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163469    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173563.1-2020s1c1
Sequence:CCGGGCACTGCTGAGATGTCTATATCTCGAGATATAGACATCTCAGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161372    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173563.1-1914s1c1
Sequence:CCGGGCCCAACTAAGATATGGTTAACTCGAGTTAACCATATCTTAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-1580s1c1
Sequence:CCGGCTCTCATTCAAACCTACTATTCTCGAGAATAGTAGGTTTGAATGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-731s1c1
Sequence:CCGGGCTTCAGTTGATAAGCAAGTTCTCGAGAACTTGCTTATCAACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-536s1c1
Sequence:CCGGGAACCTAATTTGTCGGTGCATCTCGAGATGCACCGACAAATTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-523s1c1
Sequence:CCGGGCAACTGATGCTAGAACCTAACTCGAGTTAGGTTCTAGCATCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173563
FAM217A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 217, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-794s1c1
Sequence:CCGGCCCTATGCTGATGGAGACTTTCTCGAGAAAGTCTCCATCAGCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-1133s1c1
Sequence:CCGGGCCCTCTCCAAATCTGACAATCTCGAGATTGTCAGATTTGGAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-1056s1c1
Sequence:CCGGCCGAGGAGCCAAATGAAGTATCTCGAGATACTTCATTTGGCTCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163469    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173563.1-2020s1c1
Sequence:CCGGGCACTGCTGAGATGTCTATATCTCGAGATATAGACATCTCAGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161372    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173563.1-1914s1c1
Sequence:CCGGGCCCAACTAAGATATGGTTAACTCGAGTTAACCATATCTTAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-1580s1c1
Sequence:CCGGCTCTCATTCAAACCTACTATTCTCGAGAATAGTAGGTTTGAATGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-731s1c1
Sequence:CCGGGCTTCAGTTGATAAGCAAGTTCTCGAGAACTTGCTTATCAACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-536s1c1
Sequence:CCGGGAACCTAATTTGTCGGTGCATCTCGAGATGCACCGACAAATTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173563.1-523s1c1
Sequence:CCGGGCAACTGATGCTAGAACCTAACTCGAGTTAGGTTCTAGCATCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks