EMAIL THIS PAGE TO A FRIEND

FAM217B

family with sequence similarity 217, member B

Synonyms: C20orf177 dJ551D2.5
UniProtKB ID: Q9NTX9, B3KWH1, Q9NTA3
Gene ID:
Mouse(71532) family with sequence similarity 217, member B
Rat(311692) family with sequence similarity 217, member B
naked mole-rat(101724258) family with sequence similarity 217, member B
domestic guinea pig(100713800) family with sequence similarity 217, member B
sheep(101123227) family with sequence similarity 217, member B
Zebrafish(557141) family with sequence similarity 217, member B
cow(538877) family with sequence similarity 217, member B
domestic cat(101086469) family with sequence similarity 217, member B
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022106 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081289 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081289 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081289 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022106 Rosetta Predictions human pricing
NM_001134551 Rosetta Predictions rat pricing
NM_001081289 Rosetta Predictions mouse pricing
XM_886127 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013970 predicted 699
2 SASI_Hs01_00013971 predicted 771
3 SASI_Hs02_00355496 predicted 948
4 SASI_Hs01_00013973 predicted 644
5 SASI_Hs02_00355497 predicted 754
6 SASI_Hs01_00013974 predicted 591
7 SASI_Hs01_00013975 predicted 1001
8 SASI_Hs02_00355498 predicted 1007
9 SASI_Hs01_00013977 predicted 518
10 SASI_Hs01_00013978 predicted 1178
11 SASI_Hs01_00013972 predicted 1217
12 SASI_Hs01_00013976 predicted 1477
13 SASI_Hs01_00013979 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256999 predicted 308
2 SASI_Rn02_00257000 predicted 832
3 SASI_Rn02_00257001 predicted 695
4 SASI_Rn02_00257002 predicted 274
5 SASI_Rn02_00257003 predicted 1062
6 SASI_Rn02_00257004 predicted 263
7 SASI_Rn02_00257005 predicted 819
8 SASI_Rn02_00257006 predicted 266
9 SASI_Rn02_00257007 predicted 948
10 SASI_Rn02_00257008 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081289 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297011 predicted 385
2 SASI_Mm02_00297012 predicted 364
3 SASI_Mm02_00297013 predicted 586
4 SASI_Mm02_00297014 predicted 914
5 SASI_Mm02_00297015 predicted 909
6 SASI_Mm02_00297016 predicted 1149
7 SASI_Mm02_00297017 predicted 1132
8 SASI_Mm02_00297018 predicted 1140
9 SASI_Mm02_00297019 predicted 894
10 SASI_Mm02_00297020 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251441 predicted 381
2 SASI_Mm01_00251442 predicted 366
3 SASI_Mm01_00251443 predicted 594
4 SASI_Mm01_00251444 predicted 919
5 SASI_Mm01_00251445 predicted 919
6 SASI_Mm01_00251446 predicted 1148
7 SASI_Mm01_00251447 predicted 1136
8 SASI_Mm01_00251448 predicted 1146
9 SASI_Mm01_00251449 predicted 570
10 SASI_Mm01_00251450 predicted 853
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022106
VALIDATED
FAM217B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 217, member B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_022106.1-897s1c1
Sequence:CCGGCCCTGGGAGAAGTAAGCTAATCTCGAGATTAGCTTACTTCTCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022106.1-1000s1c1
Sequence:CCGGGAAGAAATCCACCCATCACATCTCGAGATGTGATGGGTGGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022106.1-2506s1c1
Sequence:CCGGCCTTCTTATTTCACTGCAGTTCTCGAGAACTGCAGTGAAATAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138366    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022106.1-3392s1c1
Sequence:CCGGCCGTCATGTATCCATGTGCATCTCGAGATGCACATGGATACATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_022106.1-577s1c1
Sequence:CCGGGATCTCAATCTTCGAGCTGAACTCGAGTTCAGCTCGAAGATTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_022106.1-717s1c1
Sequence:CCGGGCTTCTGAACGCAGAGAACAACTCGAGTTGTTCTCTGCGTTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_022106.1-761s1c1
Sequence:CCGGGAGGACTTCTTGGGAAGTATACTCGAGTATACTTCCCAAGAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022106.1-521s21c1
Sequence:CCGGGTGATCTCTCTGATTCGGAAACTCGAGTTTCCGAATCAGAGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022106.1-1003s21c1
Sequence:CCGGGAAATCCACCCATCACATTATCTCGAGATAATGTGATGGGTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022106.1-1754s21c1
Sequence:CCGGATGCACGTAAGTATATGAAATCTCGAGATTTCATATACTTACGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022106.1-1789s21c1
Sequence:CCGGCAAATGGTGTGGAATCCTAAACTCGAGTTTAGGATTCCACACCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022106.1-601s21c1
Sequence:CCGGATTGATCCAGTTTACTTTGATCTCGAGATCAAAGTAAACTGGATCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022106
VALIDATED
FAM217B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 217, member B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_022106.1-897s1c1
Sequence:CCGGCCCTGGGAGAAGTAAGCTAATCTCGAGATTAGCTTACTTCTCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022106.1-1000s1c1
Sequence:CCGGGAAGAAATCCACCCATCACATCTCGAGATGTGATGGGTGGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022106.1-2506s1c1
Sequence:CCGGCCTTCTTATTTCACTGCAGTTCTCGAGAACTGCAGTGAAATAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138366    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022106.1-3392s1c1
Sequence:CCGGCCGTCATGTATCCATGTGCATCTCGAGATGCACATGGATACATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_022106.1-577s1c1
Sequence:CCGGGATCTCAATCTTCGAGCTGAACTCGAGTTCAGCTCGAAGATTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_022106.1-717s1c1
Sequence:CCGGGCTTCTGAACGCAGAGAACAACTCGAGTTGTTCTCTGCGTTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_022106.1-761s1c1
Sequence:CCGGGAGGACTTCTTGGGAAGTATACTCGAGTATACTTCCCAAGAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022106.1-521s21c1
Sequence:CCGGGTGATCTCTCTGATTCGGAAACTCGAGTTTCCGAATCAGAGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022106.1-1003s21c1
Sequence:CCGGGAAATCCACCCATCACATTATCTCGAGATAATGTGATGGGTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022106.1-1754s21c1
Sequence:CCGGATGCACGTAAGTATATGAAATCTCGAGATTTCATATACTTACGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022106.1-1789s21c1
Sequence:CCGGCAAATGGTGTGGAATCCTAAACTCGAGTTTAGGATTCCACACCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022106.1-601s21c1
Sequence:CCGGATTGATCCAGTTTACTTTGATCTCGAGATCAAAGTAAACTGGATCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022106
VALIDATED
FAM217B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 217, member B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_022106.1-897s1c1
Sequence:CCGGCCCTGGGAGAAGTAAGCTAATCTCGAGATTAGCTTACTTCTCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022106.1-1000s1c1
Sequence:CCGGGAAGAAATCCACCCATCACATCTCGAGATGTGATGGGTGGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022106.1-2506s1c1
Sequence:CCGGCCTTCTTATTTCACTGCAGTTCTCGAGAACTGCAGTGAAATAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138366    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022106.1-3392s1c1
Sequence:CCGGCCGTCATGTATCCATGTGCATCTCGAGATGCACATGGATACATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_022106.1-577s1c1
Sequence:CCGGGATCTCAATCTTCGAGCTGAACTCGAGTTCAGCTCGAAGATTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_022106.1-717s1c1
Sequence:CCGGGCTTCTGAACGCAGAGAACAACTCGAGTTGTTCTCTGCGTTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_022106.1-761s1c1
Sequence:CCGGGAGGACTTCTTGGGAAGTATACTCGAGTATACTTCCCAAGAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022106.1-521s21c1
Sequence:CCGGGTGATCTCTCTGATTCGGAAACTCGAGTTTCCGAATCAGAGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022106.1-1003s21c1
Sequence:CCGGGAAATCCACCCATCACATTATCTCGAGATAATGTGATGGGTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022106.1-1754s21c1
Sequence:CCGGATGCACGTAAGTATATGAAATCTCGAGATTTCATATACTTACGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022106.1-1789s21c1
Sequence:CCGGCAAATGGTGTGGAATCCTAAACTCGAGTTTAGGATTCCACACCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022106.1-601s21c1
Sequence:CCGGATTGATCCAGTTTACTTTGATCTCGAGATCAAAGTAAACTGGATCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081289
FAM217B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 217, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081289.1-1481s21c1
Sequence:CCGGAGCCAAGCAAAGCACATATAACTCGAGTTATATGTGCTTTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081289.1-920s21c1
Sequence:CCGGCAGACTTCTTCAACTAGAATGCTCGAGCATTCTAGTTGAAGAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081289.1-1742s21c1
Sequence:CCGGTTCGAGGGCCCTATAGGTAAACTCGAGTTTACCTATAGGGCCCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081289.1-898s21c1
Sequence:CCGGGATTCCTTGGGAAGTACATAGCTCGAGCTATGTACTTCCCAAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081289.1-1143s21c1
Sequence:CCGGTACTATGCATTTGAGACTTTGCTCGAGCAAAGTCTCAAATGCATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081289
FAM217B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 217, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081289.1-1481s21c1
Sequence:CCGGAGCCAAGCAAAGCACATATAACTCGAGTTATATGTGCTTTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081289.1-920s21c1
Sequence:CCGGCAGACTTCTTCAACTAGAATGCTCGAGCATTCTAGTTGAAGAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081289.1-1742s21c1
Sequence:CCGGTTCGAGGGCCCTATAGGTAAACTCGAGTTTACCTATAGGGCCCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081289.1-898s21c1
Sequence:CCGGGATTCCTTGGGAAGTACATAGCTCGAGCTATGTACTTCCCAAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081289.1-1143s21c1
Sequence:CCGGTACTATGCATTTGAGACTTTGCTCGAGCAAAGTCTCAAATGCATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081289
FAM217B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 217, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081289.1-1481s21c1
Sequence:CCGGAGCCAAGCAAAGCACATATAACTCGAGTTATATGTGCTTTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081289.1-920s21c1
Sequence:CCGGCAGACTTCTTCAACTAGAATGCTCGAGCATTCTAGTTGAAGAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081289.1-1742s21c1
Sequence:CCGGTTCGAGGGCCCTATAGGTAAACTCGAGTTTACCTATAGGGCCCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081289.1-898s21c1
Sequence:CCGGGATTCCTTGGGAAGTACATAGCTCGAGCTATGTACTTCCCAAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081289.1-1143s21c1
Sequence:CCGGTACTATGCATTTGAGACTTTGCTCGAGCAAAGTCTCAAATGCATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks