EMAIL THIS PAGE TO A FRIEND

FAM218A

family with sequence similarity 218, member A

17 Gene Product Result for
Synonyms: C4orf39
Species: Human FAM218A(152756)
UniProtKB ID: Q96MZ4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301044 ANTI-C4ORF39 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153027 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU221161 MISSION® esiRNA esiRNA targeting human C4orf39 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153027 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022004 predicted 863
2 SASI_Hs01_00022005 predicted 689
3 SASI_Hs01_00022006 predicted 961
4 SASI_Hs01_00022007 predicted 902
5 SASI_Hs01_00022008 predicted 853
6 SASI_Hs01_00022009 predicted 670
7 SASI_Hs01_00022010 predicted 988
8 SASI_Hs01_00022011 predicted 893
9 SASI_Hs01_00022012 predicted 626
10 SASI_Hs02_00366984 predicted 342
11 SASI_Hs01_00022013 predicted 833
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153027
FAM218A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 218, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-2002s1c1
Sequence:CCGGCCCAGGCACATACTCTATCTTCTCGAGAAGATAGAGTATGTGCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166014    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-1465s1c1
Sequence:CCGGGCTGTGTTTCACACTGGGTATCTCGAGATACCCAGTGTGAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164600    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-1098s1c1
Sequence:CCGGCGATTTGGAAAGACACCACAACTCGAGTTGTGGTGTCTTTCCAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164256    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-2003s1c1
Sequence:CCGGCCAGGCACATACTCTATCTTTCTCGAGAAAGATAGAGTATGTGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160108    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-1352s1c1
Sequence:CCGGCCAGTAATGTTAGGATTTGTTCTCGAGAACAAATCCTAACATTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162435    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-1666s1c1
Sequence:CCGGCCTACTCTTCAGAGATGTAATCTCGAGATTACATCTCTGAAGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-670s1c1
Sequence:CCGGGCTACCGAAGATAGTCGAATACTCGAGTATTCGACTATCTTCGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153027.1-197s1c1
Sequence:CCGGGTCTCCCTAACAGACCTTATACTCGAGTATAAGGTCTGTTAGGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-1874s1c1
Sequence:CCGGCCTGTTAAACAGAGGCATGATCTCGAGATCATGCCTCTGTTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153027
FAM218A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 218, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-2002s1c1
Sequence:CCGGCCCAGGCACATACTCTATCTTCTCGAGAAGATAGAGTATGTGCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166014    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-1465s1c1
Sequence:CCGGGCTGTGTTTCACACTGGGTATCTCGAGATACCCAGTGTGAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164600    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-1098s1c1
Sequence:CCGGCGATTTGGAAAGACACCACAACTCGAGTTGTGGTGTCTTTCCAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164256    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-2003s1c1
Sequence:CCGGCCAGGCACATACTCTATCTTTCTCGAGAAAGATAGAGTATGTGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160108    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-1352s1c1
Sequence:CCGGCCAGTAATGTTAGGATTTGTTCTCGAGAACAAATCCTAACATTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162435    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-1666s1c1
Sequence:CCGGCCTACTCTTCAGAGATGTAATCTCGAGATTACATCTCTGAAGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-670s1c1
Sequence:CCGGGCTACCGAAGATAGTCGAATACTCGAGTATTCGACTATCTTCGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153027.1-197s1c1
Sequence:CCGGGTCTCCCTAACAGACCTTATACTCGAGTATAAGGTCTGTTAGGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-1874s1c1
Sequence:CCGGCCTGTTAAACAGAGGCATGATCTCGAGATCATGCCTCTGTTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153027
FAM218A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 218, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-2002s1c1
Sequence:CCGGCCCAGGCACATACTCTATCTTCTCGAGAAGATAGAGTATGTGCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166014    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-1465s1c1
Sequence:CCGGGCTGTGTTTCACACTGGGTATCTCGAGATACCCAGTGTGAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164600    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-1098s1c1
Sequence:CCGGCGATTTGGAAAGACACCACAACTCGAGTTGTGGTGTCTTTCCAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164256    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-2003s1c1
Sequence:CCGGCCAGGCACATACTCTATCTTTCTCGAGAAAGATAGAGTATGTGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160108    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-1352s1c1
Sequence:CCGGCCAGTAATGTTAGGATTTGTTCTCGAGAACAAATCCTAACATTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162435    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-1666s1c1
Sequence:CCGGCCTACTCTTCAGAGATGTAATCTCGAGATTACATCTCTGAAGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-670s1c1
Sequence:CCGGGCTACCGAAGATAGTCGAATACTCGAGTATTCGACTATCTTCGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153027.1-197s1c1
Sequence:CCGGGTCTCCCTAACAGACCTTATACTCGAGTATAAGGTCTGTTAGGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153027.1-1874s1c1
Sequence:CCGGCCTGTTAAACAGAGGCATGATCTCGAGATCATGCCTCTGTTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks