EMAIL THIS PAGE TO A FRIEND

FAM219A

family with sequence similarity 219, member A

153 Gene Product Result for
Synonyms: C9orf25 bA573M23.5
Gene ID:
Human(203259) Summary: The protein encoded by this gene has homologs that have been identified in mouse, macaque, etc organisms. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Dec 2010]
Mouse(71901) family with sequence similarity 219, member A
Rat(691024) family with sequence similarity 219, member A
dog(474748) family with sequence similarity 219, member A
cow(614125) family with sequence similarity 219, member A
domestic cat(101090654) family with sequence similarity 219, member A
sheep(101117225) family with sequence similarity 219, member A
domestic guinea pig(100724854) family with sequence similarity 219, member A
naked mole-rat(101700830) family with sequence similarity 219, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_147202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147202 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU196981 MISSION® esiRNA esiRNA targeting mouse 2310028H24Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147202 Rosetta Predictions human pricing
NM_001109616 Rosetta Predictions rat pricing
NM_027993 Rosetta Predictions mouse pricing
XM_897013 Rosetta Predictions mouse pricing
XM_897033 Rosetta Predictions mouse pricing
XM_981399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035075 predicted 654
2 SASI_Hs01_00035084 predicted 579
3 SASI_Hs01_00035076 predicted 1045
4 SASI_Hs01_00035077 predicted 683
5 SASI_Hs01_00035078 predicted 922
6 SASI_Hs02_00365544 predicted 597
7 SASI_Hs01_00035079 predicted 598
8 SASI_Hs01_00035080 predicted 622
9 SASI_Hs01_00035082 predicted 966
10 SASI_Hs01_00035081 predicted 928
11 SASI_Hs01_00035083 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109616 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250122 predicted 430
2 SASI_Rn02_00250123 predicted 613
3 SASI_Rn02_00250124 predicted 500
4 SASI_Rn02_00250125 predicted 578
5 SASI_Rn02_00250126 predicted 1045
6 SASI_Rn02_00250127 predicted 897
7 SASI_Rn02_00250128 predicted 336
8 SASI_Rn02_00250129 predicted 897
9 SASI_Rn02_00250130 predicted 924
10 SASI_Rn02_00250131 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142498 predicted 404
2 SASI_Mm02_00333062 predicted 292
3 SASI_Mm02_00333063 predicted 298
4 SASI_Mm01_00142500 predicted 858
5 SASI_Mm01_00142502 predicted 309
6 SASI_Mm01_00142503 predicted 1005
7 SASI_Mm01_00142504 predicted 975
8 SASI_Mm01_00142505 predicted 893
9 SASI_Mm01_00142506 predicted 866
10 SASI_Mm02_00333064 predicted 466
11 SASI_Mm01_00142499 predicted 557
12 SASI_Mm01_00142501 predicted 625
13 SASI_Mm01_00142507 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256274 predicted 507
2 SASI_Mm01_00256275 predicted 1011
3 SASI_Mm01_00256276 predicted 750
4 SASI_Mm01_00256277 predicted 603
5 SASI_Mm01_00256278 predicted 984
6 SASI_Mm01_00256279 predicted 759
7 SASI_Mm01_00256280 predicted 628
8 SASI_Mm01_00256281 predicted 365
9 SASI_Mm01_00256282 predicted 489
10 SASI_Mm01_00256283 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204730 predicted 1248
2 SASI_Mm01_00204731 predicted 1242
3 SASI_Mm01_00204732 predicted 411
4 SASI_Mm01_00204733 predicted 555
5 SASI_Mm01_00204734 predicted 863
6 SASI_Mm01_00204735 predicted 618
7 SASI_Mm01_00204736 predicted 313
8 SASI_Mm01_00204737 predicted 1012
9 SASI_Mm01_00204738 predicted 978
10 SASI_Mm01_00204739 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282652 predicted 1299
2 SASI_Mm01_00282653 predicted 1298
3 SASI_Mm01_00282654 predicted 454
4 SASI_Mm01_00282655 predicted 611
5 SASI_Mm01_00282656 predicted 916
6 SASI_Mm01_00282657 predicted 674
7 SASI_Mm01_00282658 predicted 360
8 SASI_Mm01_00282659 predicted 1061
9 SASI_Mm01_00282660 predicted 1026
10 SASI_Mm01_00282661 predicted 954
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147202
VALIDATED
FAM219A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 219, member A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147202.1-655s1c1
Sequence:CCGGGCAGATCAACCAAGATTTGAACTCGAGTTCAAATCTTGGTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147202.1-478s1c1
Sequence:CCGGCAACCAGCAACCCAAGAAGAACTCGAGTTCTTCTTGGGTTGCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147202.1-608s21c1
Sequence:CCGGGACTTTGACATGTCTAGATACCTCGAGGTATCTAGACATGTCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147202.1-498s21c1
Sequence:CCGGACAATGTCATGGCCCGAACAACTCGAGTTGTTCGGGCCATGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_147202.1-1129s21c1
Sequence:CCGGACGGCAGGGAGGTCAACATTACTCGAGTAATGTTGACCTCCCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_147202.1-476s21c1
Sequence:CCGGGTCAACCAGCAACCCAAGAAGCTCGAGCTTCTTGGGTTGCTGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147202
VALIDATED
FAM219A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 219, member A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147202.1-655s1c1
Sequence:CCGGGCAGATCAACCAAGATTTGAACTCGAGTTCAAATCTTGGTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147202.1-478s1c1
Sequence:CCGGCAACCAGCAACCCAAGAAGAACTCGAGTTCTTCTTGGGTTGCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147202.1-608s21c1
Sequence:CCGGGACTTTGACATGTCTAGATACCTCGAGGTATCTAGACATGTCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147202.1-498s21c1
Sequence:CCGGACAATGTCATGGCCCGAACAACTCGAGTTGTTCGGGCCATGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_147202.1-1129s21c1
Sequence:CCGGACGGCAGGGAGGTCAACATTACTCGAGTAATGTTGACCTCCCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_147202.1-476s21c1
Sequence:CCGGGTCAACCAGCAACCCAAGAAGCTCGAGCTTCTTGGGTTGCTGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147202
VALIDATED
FAM219A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 219, member A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147202.1-655s1c1
Sequence:CCGGGCAGATCAACCAAGATTTGAACTCGAGTTCAAATCTTGGTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147202.1-478s1c1
Sequence:CCGGCAACCAGCAACCCAAGAAGAACTCGAGTTCTTCTTGGGTTGCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147202.1-608s21c1
Sequence:CCGGGACTTTGACATGTCTAGATACCTCGAGGTATCTAGACATGTCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147202.1-498s21c1
Sequence:CCGGACAATGTCATGGCCCGAACAACTCGAGTTGTTCGGGCCATGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_147202.1-1129s21c1
Sequence:CCGGACGGCAGGGAGGTCAACATTACTCGAGTAATGTTGACCTCCCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_147202.1-476s21c1
Sequence:CCGGGTCAACCAGCAACCCAAGAAGCTCGAGCTTCTTGGGTTGCTGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027993
FAM219A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 219, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027993.2-421s21c1
Sequence:CCGGCCCAAGAAGAACAACGTCATGCTCGAGCATGACGTTGTTCTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027993.2-541s21c1
Sequence:CCGGGACTTTGACATGTCCAGATACCTCGAGGTATCTGGACATGTCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027993.2-1323s21c1
Sequence:CCGGTACTGTCTCTCCATTAGATAACTCGAGTTATCTAATGGAGAGACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027993.2-620s21c1
Sequence:CCGGTGAAAGATGGCTACCGGTTAGCTCGAGCTAACCGGTAGCCATCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027993.2-585s21c1
Sequence:CCGGCGAGCAGATCAACCAAGATTTCTCGAGAAATCTTGGTTGATCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027993
FAM219A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 219, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027993.2-421s21c1
Sequence:CCGGCCCAAGAAGAACAACGTCATGCTCGAGCATGACGTTGTTCTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027993.2-541s21c1
Sequence:CCGGGACTTTGACATGTCCAGATACCTCGAGGTATCTGGACATGTCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027993.2-1323s21c1
Sequence:CCGGTACTGTCTCTCCATTAGATAACTCGAGTTATCTAATGGAGAGACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027993.2-620s21c1
Sequence:CCGGTGAAAGATGGCTACCGGTTAGCTCGAGCTAACCGGTAGCCATCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027993.2-585s21c1
Sequence:CCGGCGAGCAGATCAACCAAGATTTCTCGAGAAATCTTGGTTGATCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027993
FAM219A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 219, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027993.2-421s21c1
Sequence:CCGGCCCAAGAAGAACAACGTCATGCTCGAGCATGACGTTGTTCTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027993.2-541s21c1
Sequence:CCGGGACTTTGACATGTCCAGATACCTCGAGGTATCTGGACATGTCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027993.2-1323s21c1
Sequence:CCGGTACTGTCTCTCCATTAGATAACTCGAGTTATCTAATGGAGAGACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027993.2-620s21c1
Sequence:CCGGTGAAAGATGGCTACCGGTTAGCTCGAGCTAACCGGTAGCCATCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027993.2-585s21c1
Sequence:CCGGCGAGCAGATCAACCAAGATTTCTCGAGAAATCTTGGTTGATCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks