EMAIL THIS PAGE TO A FRIEND

FAM219B

family with sequence similarity 219, member B

Synonyms: C15orf17
UniProtKB ID: Q5XKK7, A8K4Q5, B4DK57, Q9NXY0
Gene ID:
Mouse(78323) family with sequence similarity 219, member B
Zebrafish(541542) family with sequence similarity 219, member B
chicken(101751273) family with sequence similarity 219, member B
chicken(101665940) family with sequence similarity 219, member B
domestic cat(101082063) family with sequence similarity 219, member B
naked mole-rat(101713483) family with sequence similarity 219, member B
domestic guinea pig(100713719) family with sequence similarity 219, member B
sheep(101107636) family with sequence similarity 219, member B
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175273 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175273 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175273 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020447 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU061471 MISSION® esiRNA esiRNA targeting mouse 2310046O06Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020447 Rosetta Predictions human pricing
NM_175273 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118208 predicted 775
2 SASI_Hs01_00118209 predicted 1223
3 SASI_Hs02_00353482 predicted 1376
4 SASI_Hs01_00118210 predicted 1085
5 SASI_Hs01_00118211 predicted 1133
6 SASI_Hs01_00118212 predicted 786
7 SASI_Hs02_00353483 predicted 892
8 SASI_Hs01_00118215 predicted 516
9 SASI_Hs01_00118216 predicted 1351
10 SASI_Hs01_00118217 predicted 1173
11 SASI_Hs01_00118213 predicted 1075
12 SASI_Hs01_00118214 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175273 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150904 predicted 694
2 SASI_Mm01_00150905 predicted 871
3 SASI_Mm01_00150906 predicted 891
4 SASI_Mm01_00150907 predicted 665
5 SASI_Mm01_00150908 predicted 276
6 SASI_Mm01_00150909 predicted 562
7 SASI_Mm01_00150910 predicted 359
8 SASI_Mm01_00150911 predicted 557
9 SASI_Mm02_00345997 predicted 708
10 SASI_Mm01_00150912 predicted 507
11 SASI_Mm01_00150903 predicted 414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175273
VALIDATED
FAM219B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 219, member B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175273.3-365s21c1
Sequence:CCGGTGACGAACCGACCCGATTCTTCTCGAGAAGAATCGGGTCGGTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175273.3-283s21c1
Sequence:CCGGGCACCTTCCATTCAGGCTAAGCTCGAGCTTAGCCTGAATGGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175273.3-411s21c1
Sequence:CCGGCAAGGGCTACACTGCTCTTAGCTCGAGCTAAGAGCAGTGTAGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175273.3-327s21c1
Sequence:CCGGCAAGGCCGTTCTGCGGAGAAACTCGAGTTTCTCCGCAGAACGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175273.3-1088s21c1
Sequence:CCGGACAGCAAGGAATCTAACTTAACTCGAGTTAAGTTAGATTCCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175273.2-2037s1c1
Sequence:CCGGCCAGTGATTACTGGAGGCTTACTCGAGTAAGCCTCCAGTAATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175273.2-403s1c1
Sequence:CCGGGAAGTTTAACAAGGGCTACACCTCGAGGTGTAGCCCTTGTTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175273
VALIDATED
FAM219B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 219, member B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175273.3-365s21c1
Sequence:CCGGTGACGAACCGACCCGATTCTTCTCGAGAAGAATCGGGTCGGTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175273.3-283s21c1
Sequence:CCGGGCACCTTCCATTCAGGCTAAGCTCGAGCTTAGCCTGAATGGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175273.3-411s21c1
Sequence:CCGGCAAGGGCTACACTGCTCTTAGCTCGAGCTAAGAGCAGTGTAGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175273.3-327s21c1
Sequence:CCGGCAAGGCCGTTCTGCGGAGAAACTCGAGTTTCTCCGCAGAACGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175273.3-1088s21c1
Sequence:CCGGACAGCAAGGAATCTAACTTAACTCGAGTTAAGTTAGATTCCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175273.2-2037s1c1
Sequence:CCGGCCAGTGATTACTGGAGGCTTACTCGAGTAAGCCTCCAGTAATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175273.2-403s1c1
Sequence:CCGGGAAGTTTAACAAGGGCTACACCTCGAGGTGTAGCCCTTGTTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175273
VALIDATED
FAM219B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 219, member B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175273.3-365s21c1
Sequence:CCGGTGACGAACCGACCCGATTCTTCTCGAGAAGAATCGGGTCGGTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175273.3-283s21c1
Sequence:CCGGGCACCTTCCATTCAGGCTAAGCTCGAGCTTAGCCTGAATGGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175273.3-411s21c1
Sequence:CCGGCAAGGGCTACACTGCTCTTAGCTCGAGCTAAGAGCAGTGTAGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175273.3-327s21c1
Sequence:CCGGCAAGGCCGTTCTGCGGAGAAACTCGAGTTTCTCCGCAGAACGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175273.3-1088s21c1
Sequence:CCGGACAGCAAGGAATCTAACTTAACTCGAGTTAAGTTAGATTCCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175273.2-2037s1c1
Sequence:CCGGCCAGTGATTACTGGAGGCTTACTCGAGTAAGCCTCCAGTAATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175273.2-403s1c1
Sequence:CCGGGAAGTTTAACAAGGGCTACACCTCGAGGTGTAGCCCTTGTTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020447
FAM219B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 219, member B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020447.2-513s1c1
Sequence:CCGGCACCTGGATGAGATTCCAGATCTCGAGATCTGGAATCTCATCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020447.2-519s1c1
Sequence:CCGGGATGAGATTCCAGATGACGAGCTCGAGCTCGTCATCTGGAATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020447.2-935s1c1
Sequence:CCGGGCAGACAGCTTGATTGGTATTCTCGAGAATACCAATCAAGCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163104    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020447.2-1109s1c1
Sequence:CCGGGCTCTATTCTTCCTAGCTCTACTCGAGTAGAGCTAGGAAGAATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020447.2-345s1c1
Sequence:CCGGGTGAAGTTTAACAAGGGCTATCTCGAGATAGCCCTTGTTAAACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162946    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020447.2-1001s1c1
Sequence:CCGGGCTGTGCTAGATAGTGTTGAACTCGAGTTCAACACTATCTAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020447.2-515s1c1
Sequence:CCGGCCTGGATGAGATTCCAGATGACTCGAGTCATCTGGAATCTCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020447
FAM219B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 219, member B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020447.2-513s1c1
Sequence:CCGGCACCTGGATGAGATTCCAGATCTCGAGATCTGGAATCTCATCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020447.2-519s1c1
Sequence:CCGGGATGAGATTCCAGATGACGAGCTCGAGCTCGTCATCTGGAATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020447.2-935s1c1
Sequence:CCGGGCAGACAGCTTGATTGGTATTCTCGAGAATACCAATCAAGCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163104    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020447.2-1109s1c1
Sequence:CCGGGCTCTATTCTTCCTAGCTCTACTCGAGTAGAGCTAGGAAGAATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020447.2-345s1c1
Sequence:CCGGGTGAAGTTTAACAAGGGCTATCTCGAGATAGCCCTTGTTAAACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162946    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020447.2-1001s1c1
Sequence:CCGGGCTGTGCTAGATAGTGTTGAACTCGAGTTCAACACTATCTAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020447.2-515s1c1
Sequence:CCGGCCTGGATGAGATTCCAGATGACTCGAGTCATCTGGAATCTCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020447
FAM219B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 219, member B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020447.2-513s1c1
Sequence:CCGGCACCTGGATGAGATTCCAGATCTCGAGATCTGGAATCTCATCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020447.2-519s1c1
Sequence:CCGGGATGAGATTCCAGATGACGAGCTCGAGCTCGTCATCTGGAATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020447.2-935s1c1
Sequence:CCGGGCAGACAGCTTGATTGGTATTCTCGAGAATACCAATCAAGCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163104    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020447.2-1109s1c1
Sequence:CCGGGCTCTATTCTTCCTAGCTCTACTCGAGTAGAGCTAGGAAGAATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020447.2-345s1c1
Sequence:CCGGGTGAAGTTTAACAAGGGCTATCTCGAGATAGCCCTTGTTAAACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162946    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020447.2-1001s1c1
Sequence:CCGGGCTGTGCTAGATAGTGTTGAACTCGAGTTCAACACTATCTAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020447.2-515s1c1
Sequence:CCGGCCTGGATGAGATTCCAGATGACTCGAGTCATCTGGAATCTCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks