EMAIL THIS PAGE TO A FRIEND

FAM21B

family with sequence similarity 21, member B

Synonyms: FAM21A bA98I6.1
Species: Human FAM21B(55747)
UniProtKB ID: Q5SNT6
Gene ID:
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018232 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116161 MISSION® esiRNA esiRNA human FAM21B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018232 Rosetta Predictions human pricing
XM_290482 Rosetta Predictions human pricing
XM_932744 Rosetta Predictions human pricing
XM_932746 Rosetta Predictions human pricing
XM_932748 Rosetta Predictions human pricing
XM_932751 Rosetta Predictions human pricing
XM_932753 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351556 predicted 2806
2 SASI_Hs02_00351557 predicted 2103
3 SASI_Hs02_00351558 predicted 1895
4 SASI_Hs02_00351559 predicted 3240
5 SASI_Hs02_00351560 predicted 2339
6 SASI_Hs02_00351561 predicted 266
7 SASI_Hs02_00351562 predicted 2546
8 SASI_Hs02_00351563 predicted 1512
9 SASI_Hs02_00351564 predicted 3623
10 SASI_Hs02_00351565 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287672 predicted 2716
2 SASI_Hs01_00287673 predicted 2005
3 SASI_Hs01_00287674 predicted 1798
4 SASI_Hs01_00287675 predicted 3150
5 SASI_Hs01_00287676 predicted 2238
6 SASI_Hs01_00287677 predicted 2444
7 SASI_Hs01_00287678 predicted 1411
8 SASI_Hs01_00287679 predicted 3526
9 SASI_Hs01_00287680 predicted 1538
10 SASI_Hs01_00287681 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274641 predicted 1680
2 SASI_Hs01_00274642 predicted 1598
3 SASI_Hs01_00274643 predicted 1565
4 SASI_Hs01_00274644 predicted 1791
5 SASI_Hs01_00274645 predicted 2123
6 SASI_Hs01_00274646 predicted 1788
7 SASI_Hs01_00274647 predicted 1863
8 SASI_Hs01_00274648 predicted 1951
9 SASI_Hs01_00274649 predicted 1974
10 SASI_Hs01_00274650 predicted 1832
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299209 predicted 2220
2 SASI_Hs01_00299210 predicted 2135
3 SASI_Hs01_00299211 predicted 2115
4 SASI_Hs01_00299212 predicted 2332
5 SASI_Hs01_00299213 predicted 2666
6 SASI_Hs01_00299214 predicted 2333
7 SASI_Hs01_00299215 predicted 2400
8 SASI_Hs01_00299216 predicted 2486
9 SASI_Hs01_00299217 predicted 2514
10 SASI_Hs01_00299218 predicted 2373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270796 predicted 1264
2 SASI_Hs01_00270797 predicted 563
3 SASI_Hs01_00270798 predicted 353
4 SASI_Hs01_00270799 predicted 1693
5 SASI_Hs01_00270800 predicted 795
6 SASI_Hs01_00270801 predicted 995
7 SASI_Hs01_00270802 predicted 2070
8 SASI_Hs01_00270803 predicted 257
9 SASI_Hs01_00270804 predicted 2097
10 SASI_Hs01_00270805 predicted 2255
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288072 predicted 202
2 SASI_Hs01_00288073 predicted 205
3 SASI_Hs01_00288074 predicted 197
4 SASI_Hs01_00288075 predicted 200
5 SASI_Hs01_00288076 predicted 386
6 SASI_Hs01_00288077 predicted 371
7 SASI_Hs01_00288078 predicted 198
8 SASI_Hs01_00288079 predicted 380
9 SASI_Hs01_00288080 predicted 194
10 SASI_Hs01_00288081 predicted 138
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298683 predicted 289
2 SASI_Hs01_00298684 predicted 292
3 SASI_Hs01_00298685 predicted 282
4 SASI_Hs01_00298686 predicted 386
5 SASI_Hs01_00298687 predicted 386
6 SASI_Hs01_00298688 predicted 473
7 SASI_Hs01_00298689 predicted 333
8 SASI_Hs01_00298690 predicted 353
9 SASI_Hs01_00298691 predicted 437
10 SASI_Hs01_00298692 predicted 441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018232
VALIDATED
FAM21B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 21, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018232.1-4123s21c1
Sequence:CCGGTGGATGGGAACCCTAACTTAGCTCGAGCTAAGTTAGGGTTCCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018232.1-2494s21c1
Sequence:CCGGGAATCCATTCAAGGTAGTAAACTCGAGTTTACTACCTTGAATGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018232.1-252s21c1
Sequence:CCGGCCTTGAACCAAAGGATCTATACTCGAGTATAGATCCTTTGGTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018232.1-3588s21c1
Sequence:CCGGAGTGGAAGCCAAGTCTATATTCTCGAGAATATAGACTTGGCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018232.1-1162s21c1
Sequence:CCGGGTCCAATCCACTGCCGATATCCTCGAGGATATCGGCAGTGGATTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018232
VALIDATED
FAM21B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 21, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018232.1-4123s21c1
Sequence:CCGGTGGATGGGAACCCTAACTTAGCTCGAGCTAAGTTAGGGTTCCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018232.1-2494s21c1
Sequence:CCGGGAATCCATTCAAGGTAGTAAACTCGAGTTTACTACCTTGAATGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018232.1-252s21c1
Sequence:CCGGCCTTGAACCAAAGGATCTATACTCGAGTATAGATCCTTTGGTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018232.1-3588s21c1
Sequence:CCGGAGTGGAAGCCAAGTCTATATTCTCGAGAATATAGACTTGGCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018232.1-1162s21c1
Sequence:CCGGGTCCAATCCACTGCCGATATCCTCGAGGATATCGGCAGTGGATTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018232
VALIDATED
FAM21B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 21, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018232.1-4123s21c1
Sequence:CCGGTGGATGGGAACCCTAACTTAGCTCGAGCTAAGTTAGGGTTCCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018232.1-2494s21c1
Sequence:CCGGGAATCCATTCAAGGTAGTAAACTCGAGTTTACTACCTTGAATGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018232.1-252s21c1
Sequence:CCGGCCTTGAACCAAAGGATCTATACTCGAGTATAGATCCTTTGGTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018232.1-3588s21c1
Sequence:CCGGAGTGGAAGCCAAGTCTATATTCTCGAGAATATAGACTTGGCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018232.1-1162s21c1
Sequence:CCGGGTCCAATCCACTGCCGATATCCTCGAGGATATCGGCAGTGGATTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks