EMAIL THIS PAGE TO A FRIEND

FAM21C

family with sequence similarity 21, member C

28 Gene Product Result for
Synonyms: FAM21A VPEF
Gene ID:
Rat(297530) family with sequence similarity 21, member C
Zebrafish(567272) family with sequence similarity 21, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408450 Anti-FAM21C antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015262 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015262 Rosetta Predictions human pricing
NM_199207 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233696 predicted 3100
2 SASI_Hs01_00233697 predicted 2461
3 SASI_Hs01_00233698 predicted 2252
4 SASI_Hs01_00233699 predicted 254
5 SASI_Hs01_00233700 predicted 374
6 SASI_Hs01_00233701 predicted 2693
7 SASI_Hs01_00233702 predicted 2889
8 SASI_Hs01_00233703 predicted 459
9 SASI_Hs01_00233704 predicted 275
10 SASI_Hs01_00233705 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069110 predicted 888
2 SASI_Rn01_00069111 predicted 899
3 SASI_Rn01_00069112 predicted 234
4 SASI_Rn01_00069113 predicted 1424
5 SASI_Rn01_00069114 predicted 3236
6 SASI_Rn02_00270149 predicted 1371
7 SASI_Rn01_00069115 predicted 586
8 SASI_Rn01_00069116 predicted 341
9 SASI_Rn01_00069117 predicted 513
10 SASI_Rn01_00069118 predicted 405
11 SASI_Rn01_00069109 predicted 813
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015262
VALIDATED
FAM21C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 21, member C
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015262.1-1100s21c1
Sequence:CCGGACGATGAAGAGGATAACTTATCTCGAGATAAGTTATCCTCTTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015262.1-2892s21c1
Sequence:CCGGGGAAACACCTCAGGCAAATTTCTCGAGAAATTTGCCTGAGGTGTTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015262.1-378s21c1
Sequence:CCGGGTTCATAGAGAATCGTGTATACTCGAGTATACACGATTCTCTATGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015262.1-1958s21c1
Sequence:CCGGGTGATGAGGAGTGGAATATTCCTCGAGGAATATTCCACTCCTCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015262.1-4178s21c1
Sequence:CCGGTTACCCAATGTACTTAGTATTCTCGAGAATACTAAGTACATTGGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015262.1-285s21c1
Sequence:CCGGGAAACAAGTGGACGGACTAATCTCGAGATTAGTCCGTCCACTTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015262.1-3979s21c1
Sequence:CCGGGCCGCACCTGAACCAAGATTTCTCGAGAAATCTTGGTTCAGGTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015262.1-2334s21c1
Sequence:CCGGGAGTGCCAAGGAGTCATTAAACTCGAGTTTAATGACTCCTTGGCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015262.1-502s1c1
Sequence:CCGGGAGGCTGTGAACTATGGCTTACTCGAGTAAGCCATAGTTCACAGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015262.1-4123s1c1
Sequence:CCGGCTCATGGTCTTAACTGGATTACTCGAGTAATCCAGTTAAGACCATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015262.1-4088s1c1
Sequence:CCGGGCTACATTGTTGAGTTAGTGACTCGAGTCACTAACTCAACAATGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015262.1-1265s1c1
Sequence:CCGGCCTCTGTTAAGGAGGAGTCTTCTCGAGAAGACTCCTCCTTAACAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015262.1-463s1c1
Sequence:CCGGCGAGAGCAGAAAGAAGTAGATCTCGAGATCTACTTCTTTCTGCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015262.1-363s1c1
Sequence:CCGGGCTCTCTAATACCCAGTTCATCTCGAGATGAACTGGGTATTAGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015262
VALIDATED
FAM21C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 21, member C
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015262.1-1100s21c1
Sequence:CCGGACGATGAAGAGGATAACTTATCTCGAGATAAGTTATCCTCTTCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015262.1-2892s21c1
Sequence:CCGGGGAAACACCTCAGGCAAATTTCTCGAGAAATTTGCCTGAGGTGTTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015262.1-378s21c1
Sequence:CCGGGTTCATAGAGAATCGTGTATACTCGAGTATACACGATTCTCTATGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015262.1-1958s21c1
Sequence:CCGGGTGATGAGGAGTGGAATATTCCTCGAGGAATATTCCACTCCTCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015262.1-4178s21c1
Sequence:CCGGTTACCCAATGTACTTAGTATTCTCGAGAATACTAAGTACATTGGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015262.1-285s21c1
Sequence:CCGGGAAACAAGTGGACGGACTAATCTCGAGATTAGTCCGTCCACTTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015262.1-3979s21c1
Sequence:CCGGGCCGCACCTGAACCAAGATTTCTCGAGAAATCTTGGTTCAGGTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015262.1-2334s21c1
Sequence:CCGGGAGTGCCAAGGAGTCATTAAACTCGAGTTTAATGACTCCTTGGCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015262.1-502s1c1
Sequence:CCGGGAGGCTGTGAACTATGGCTTACTCGAGTAAGCCATAGTTCACAGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015262.1-4123s1c1
Sequence:CCGGCTCATGGTCTTAACTGGATTACTCGAGTAATCCAGTTAAGACCATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015262.1-4088s1c1
Sequence:CCGGGCTACATTGTTGAGTTAGTGACTCGAGTCACTAACTCAACAATGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015262.1-1265s1c1
Sequence:CCGGCCTCTGTTAAGGAGGAGTCTTCTCGAGAAGACTCCTCCTTAACAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015262.1-463s1c1
Sequence:CCGGCGAGAGCAGAAAGAAGTAGATCTCGAGATCTACTTCTTTCTGCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015262.1-363s1c1
Sequence:CCGGGCTCTCTAATACCCAGTTCATCTCGAGATGAACTGGGTATTAGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015262
VALIDATED
FAM21C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 21, member C
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015262.1-1100s21c1
Sequence:CCGGACGATGAAGAGGATAACTTATCTCGAGATAAGTTATCCTCTTCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015262.1-2892s21c1
Sequence:CCGGGGAAACACCTCAGGCAAATTTCTCGAGAAATTTGCCTGAGGTGTTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015262.1-378s21c1
Sequence:CCGGGTTCATAGAGAATCGTGTATACTCGAGTATACACGATTCTCTATGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015262.1-1958s21c1
Sequence:CCGGGTGATGAGGAGTGGAATATTCCTCGAGGAATATTCCACTCCTCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015262.1-4178s21c1
Sequence:CCGGTTACCCAATGTACTTAGTATTCTCGAGAATACTAAGTACATTGGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015262.1-285s21c1
Sequence:CCGGGAAACAAGTGGACGGACTAATCTCGAGATTAGTCCGTCCACTTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015262.1-3979s21c1
Sequence:CCGGGCCGCACCTGAACCAAGATTTCTCGAGAAATCTTGGTTCAGGTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015262.1-2334s21c1
Sequence:CCGGGAGTGCCAAGGAGTCATTAAACTCGAGTTTAATGACTCCTTGGCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015262.1-502s1c1
Sequence:CCGGGAGGCTGTGAACTATGGCTTACTCGAGTAAGCCATAGTTCACAGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015262.1-4123s1c1
Sequence:CCGGCTCATGGTCTTAACTGGATTACTCGAGTAATCCAGTTAAGACCATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015262.1-4088s1c1
Sequence:CCGGGCTACATTGTTGAGTTAGTGACTCGAGTCACTAACTCAACAATGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015262.1-1265s1c1
Sequence:CCGGCCTCTGTTAAGGAGGAGTCTTCTCGAGAAGACTCCTCCTTAACAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015262.1-463s1c1
Sequence:CCGGCGAGAGCAGAAAGAAGTAGATCTCGAGATCTACTTCTTTCTGCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015262.1-363s1c1
Sequence:CCGGGCTCTCTAATACCCAGTTCATCTCGAGATGAACTGGGTATTAGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)