EMAIL THIS PAGE TO A FRIEND

FAM220A

family with sequence similarity 220, member A

70 Gene Product Result for
Synonyms: C7orf70 SIPAR
UniProtKB ID: Q7Z4H9, Q75ML2, Q8NA52, Q9BRR7
Gene ID:
Mouse(67238) family with sequence similarity 220, member A
Rat(498145) family with sequence similarity 220, member A
domestic guinea pig(100718487) family with sequence similarity 220, member A
naked mole-rat(101702606) family with sequence similarity 220, member A
domestic cat(101101528) family with sequence similarity 220, member A
dog(100683001) family with sequence similarity 220, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA055050 Anti-FAM220A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032706 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026050 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026050 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026050 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001037163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037163 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037163 Rosetta Predictions human pricing
NM_001017485 Rosetta Predictions rat pricing
NM_026050 Rosetta Predictions mouse pricing
NM_133703 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087878 predicted 1432
2 SASI_Hs01_00087879 predicted 543
3 SASI_Hs01_00087880 predicted 1489
4 SASI_Hs01_00087881 predicted 1368
5 SASI_Hs01_00087882 predicted 1531
6 SASI_Hs01_00087885 predicted 1252
7 SASI_Hs02_00308224 predicted 1533
8 SASI_Hs01_00087886 predicted 1495
9 SASI_Hs01_00087887 predicted 1522
10 SASI_Hs02_00308225 predicted 1544
11 SASI_Hs01_00087883 predicted 1382
12 SASI_Hs01_00087884 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017485 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032184 predicted 1214
2 SASI_Rn01_00032186 predicted 1381
3 SASI_Rn01_00032187 predicted 936
4 SASI_Rn01_00032188 predicted 1262
5 SASI_Rn01_00032190 predicted 842
6 SASI_Rn01_00032191 predicted 1115
7 SASI_Rn01_00032192 predicted 216
8 SASI_Rn01_00032193 predicted 1237
9 SASI_Rn02_00202298 predicted 356
10 SASI_Rn02_00202299 predicted 980
11 SASI_Rn01_00032185 predicted 281
12 SASI_Rn01_00032189 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026050 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097987 predicted 1270
2 SASI_Mm01_00097988 predicted 1289
3 SASI_Mm02_00329557 predicted 797
4 SASI_Mm02_00329558 predicted 783
5 SASI_Mm02_00329559 predicted 1833
6 SASI_Mm02_00329560 predicted 770
7 SASI_Mm02_00329561 predicted 1064
8 SASI_Mm02_00329562 predicted 1124
9 SASI_Mm02_00329563 predicted 1186
10 SASI_Mm02_00329564 predicted 1288
11 SASI_Mm01_00097989 predicted 1724
12 SASI_Mm01_00097990 predicted 1612
13 SASI_Mm01_00097991 predicted 1762
14 SASI_Mm01_00097992 predicted 1615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166851 predicted 1133
2 SASI_Mm01_00166852 predicted 1153
3 SASI_Mm02_00338662 predicted 659
4 SASI_Mm02_00338663 predicted 648
5 SASI_Mm02_00338664 predicted 1704
6 SASI_Mm02_00338665 predicted 632
7 SASI_Mm02_00338666 predicted 931
8 SASI_Mm02_00338667 predicted 983
9 SASI_Mm02_00338668 predicted 1049
10 SASI_Mm02_00338669 predicted 1152
11 SASI_Mm01_00166853 predicted 1533
12 SASI_Mm01_00166854 predicted 1679
13 SASI_Mm01_00166855 predicted 1536
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032706
FAM220A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 220, member A
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000180857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032706.1-380s1c1
Sequence:CCGGGCCTGCAGGTTCATATTGAGACTCGAGTCTCAATATGAACCTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032706.1-382s1c1
Sequence:CCGGCTGCAGGTTCATATTGAGATCCTCGAGGATCTCAATATGAACCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032706
FAM220A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 220, member A
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000180857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032706.1-380s1c1
Sequence:CCGGGCCTGCAGGTTCATATTGAGACTCGAGTCTCAATATGAACCTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032706.1-382s1c1
Sequence:CCGGCTGCAGGTTCATATTGAGATCCTCGAGGATCTCAATATGAACCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032706
FAM220A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 220, member A
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000180857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032706.1-380s1c1
Sequence:CCGGGCCTGCAGGTTCATATTGAGACTCGAGTCTCAATATGAACCTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032706.1-382s1c1
Sequence:CCGGCTGCAGGTTCATATTGAGATCCTCGAGGATCTCAATATGAACCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026050
VALIDATED
FAM220A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 220, member A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026050.1-904s1c1
Sequence:CCGGGCTCCTTCAGAAGAGCAACTACTCGAGTAGTTGCTCTTCTGAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026050.1-1122s1c1
Sequence:CCGGGTCAGAACTGTCTCACCGATACTCGAGTATCGGTGAGACAGTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026050.1-1213s1c1
Sequence:CCGGGTGTCCCTTGACCGTTTCAATCTCGAGATTGAAACGGTCAAGGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026050.1-1774s1c1
Sequence:CCGGGCTTGCCATTTCTGCACTGTACTCGAGTACAGTGCAGAAATGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026050.2-1842s21c1
Sequence:CCGGGCTTGCCATTTCTGCACTGTACTCGAGTACAGTGCAGAAATGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026050.2-1280s21c1
Sequence:CCGGGTGTCCCTTGACCGTTTCAATCTCGAGATTGAAACGGTCAAGGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026050.2-1650s21c1
Sequence:CCGGTGATTGATGTGCTCCGTATAACTCGAGTTATACGGAGCACATCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026050.2-1685s21c1
Sequence:CCGGCTTTATCACAGAGTTCTAAATCTCGAGATTTAGAACTCTGTGATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026050.2-870s21c1
Sequence:CCGGTGCATCATGGTGGCTTCAAAGCTCGAGCTTTGAAGCCACCATGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026050
VALIDATED
FAM220A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 220, member A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026050.1-904s1c1
Sequence:CCGGGCTCCTTCAGAAGAGCAACTACTCGAGTAGTTGCTCTTCTGAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026050.1-1122s1c1
Sequence:CCGGGTCAGAACTGTCTCACCGATACTCGAGTATCGGTGAGACAGTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026050.1-1213s1c1
Sequence:CCGGGTGTCCCTTGACCGTTTCAATCTCGAGATTGAAACGGTCAAGGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026050.1-1774s1c1
Sequence:CCGGGCTTGCCATTTCTGCACTGTACTCGAGTACAGTGCAGAAATGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026050.2-1842s21c1
Sequence:CCGGGCTTGCCATTTCTGCACTGTACTCGAGTACAGTGCAGAAATGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026050.2-1280s21c1
Sequence:CCGGGTGTCCCTTGACCGTTTCAATCTCGAGATTGAAACGGTCAAGGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026050.2-1650s21c1
Sequence:CCGGTGATTGATGTGCTCCGTATAACTCGAGTTATACGGAGCACATCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026050.2-1685s21c1
Sequence:CCGGCTTTATCACAGAGTTCTAAATCTCGAGATTTAGAACTCTGTGATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026050.2-870s21c1
Sequence:CCGGTGCATCATGGTGGCTTCAAAGCTCGAGCTTTGAAGCCACCATGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026050
VALIDATED
FAM220A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 220, member A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026050.1-904s1c1
Sequence:CCGGGCTCCTTCAGAAGAGCAACTACTCGAGTAGTTGCTCTTCTGAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026050.1-1122s1c1
Sequence:CCGGGTCAGAACTGTCTCACCGATACTCGAGTATCGGTGAGACAGTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026050.1-1213s1c1
Sequence:CCGGGTGTCCCTTGACCGTTTCAATCTCGAGATTGAAACGGTCAAGGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026050.1-1774s1c1
Sequence:CCGGGCTTGCCATTTCTGCACTGTACTCGAGTACAGTGCAGAAATGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026050.2-1842s21c1
Sequence:CCGGGCTTGCCATTTCTGCACTGTACTCGAGTACAGTGCAGAAATGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026050.2-1280s21c1
Sequence:CCGGGTGTCCCTTGACCGTTTCAATCTCGAGATTGAAACGGTCAAGGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026050.2-1650s21c1
Sequence:CCGGTGATTGATGTGCTCCGTATAACTCGAGTTATACGGAGCACATCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026050.2-1685s21c1
Sequence:CCGGCTTTATCACAGAGTTCTAAATCTCGAGATTTAGAACTCTGTGATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026050.2-870s21c1
Sequence:CCGGTGCATCATGGTGGCTTCAAAGCTCGAGCTTTGAAGCCACCATGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037163
VALIDATED
FAM220A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 220, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037163.1-1229s21c1
Sequence:CCGGATACATTATGCCATAGTTAAGCTCGAGCTTAACTATGGCATAATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001037163.1-649s21c1
Sequence:CCGGTTATCACTGGAAATGAGAAAGCTCGAGCTTTCTCATTTCCAGTGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001037163.1-1296s21c1
Sequence:CCGGGAATGATTTCTTTCGCATTAACTCGAGTTAATGCGAAAGAAATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037163.1-968s21c1
Sequence:CCGGTTCAGGATGACCCACCAAGTGCTCGAGCACTTGGTGGGTCATCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_001037163.1-1045s21c1
Sequence:CCGGTCTGCAACGCTGCACGTGTATCTCGAGATACACGTGCAGCGTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037163
VALIDATED
FAM220A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 220, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037163.1-1229s21c1
Sequence:CCGGATACATTATGCCATAGTTAAGCTCGAGCTTAACTATGGCATAATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001037163.1-649s21c1
Sequence:CCGGTTATCACTGGAAATGAGAAAGCTCGAGCTTTCTCATTTCCAGTGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001037163.1-1296s21c1
Sequence:CCGGGAATGATTTCTTTCGCATTAACTCGAGTTAATGCGAAAGAAATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037163.1-968s21c1
Sequence:CCGGTTCAGGATGACCCACCAAGTGCTCGAGCACTTGGTGGGTCATCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_001037163.1-1045s21c1
Sequence:CCGGTCTGCAACGCTGCACGTGTATCTCGAGATACACGTGCAGCGTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037163
VALIDATED
FAM220A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 220, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037163.1-1229s21c1
Sequence:CCGGATACATTATGCCATAGTTAAGCTCGAGCTTAACTATGGCATAATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001037163.1-649s21c1
Sequence:CCGGTTATCACTGGAAATGAGAAAGCTCGAGCTTTCTCATTTCCAGTGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001037163.1-1296s21c1
Sequence:CCGGGAATGATTTCTTTCGCATTAACTCGAGTTAATGCGAAAGAAATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037163.1-968s21c1
Sequence:CCGGTTCAGGATGACCCACCAAGTGCTCGAGCACTTGGTGGGTCATCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_001037163.1-1045s21c1
Sequence:CCGGTCTGCAACGCTGCACGTGTATCTCGAGATACACGTGCAGCGTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks