EMAIL THIS PAGE TO A FRIEND

FAM221A

family with sequence similarity 221, member A

102 Gene Product Result for
Synonyms: C7orf46
UniProtKB ID: A4D161, Q05CG4, Q4G0Q7, Q6P519
Gene ID:
Mouse(231946) family with sequence similarity 221, member A
Rat(500118) family with sequence similarity 221, member A
Zebrafish(541338) family with sequence similarity 221, member A
cow(505226) family with sequence similarity 221, member A
domestic cat(101091775) family with sequence similarity 221, member A
dog(482361) family with sequence similarity 221, member A
naked mole-rat(101722374) family with sequence similarity 221, member A
domestic guinea pig(100712913) family with sequence similarity 221, member A
sheep(101110322) family with sequence similarity 221, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199136 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199136 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199136 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172727 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172727 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172727 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018331 MISSION® esiRNA esiRNA targeting human C7orf46 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127364 Rosetta Predictions human pricing
NM_001127365 Rosetta Predictions human pricing
NM_199136 Rosetta Predictions human pricing
NM_001025771 Rosetta Predictions rat pricing
NM_172727 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329234 predicted 765
2 SASI_Hs02_00329235 predicted 734
3 SASI_Hs02_00329236 predicted 714
4 SASI_Hs02_00329237 predicted 878
5 SASI_Hs02_00329238 predicted 688
6 SASI_Hs02_00329239 predicted 721
7 SASI_Hs02_00329240 predicted 602
8 SASI_Hs02_00329241 predicted 771
9 SASI_Hs02_00329242 predicted 788
10 SASI_Hs02_00329243 predicted 161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329244 predicted 593
2 SASI_Hs02_00329245 predicted 566
3 SASI_Hs02_00329246 predicted 546
4 SASI_Hs02_00329247 predicted 704
5 SASI_Hs02_00329248 predicted 513
6 SASI_Hs02_00329249 predicted 545
7 SASI_Hs02_00329250 predicted 425
8 SASI_Hs02_00329251 predicted 591
9 SASI_Hs02_00329252 predicted 698
10 SASI_Hs02_00329253 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372577 predicted 877
2 SASI_Hs01_00048001 predicted 844
3 SASI_Hs02_00372578 predicted 986
4 SASI_Hs01_00048002 predicted 834
5 SASI_Hs01_00048003 predicted 750
6 SASI_Hs01_00048005 predicted 320
7 SASI_Hs02_00372579 predicted 973
8 SASI_Hs02_00372580 predicted 982
9 SASI_Hs01_00048008 predicted 764
10 SASI_Hs02_00372581 predicted 802
11 SASI_Hs01_00048000 predicted 655
12 SASI_Hs01_00048004 predicted 324
13 SASI_Hs01_00048006 predicted 384
14 SASI_Hs01_00048007 predicted 208
15 SASI_Hs01_00048009 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203449 predicted 907
2 SASI_Rn01_00105923 predicted 1042
3 SASI_Rn01_00105924 predicted 670
4 SASI_Rn01_00105925 predicted 900
5 SASI_Rn01_00105926 predicted 730
6 SASI_Rn01_00105927 predicted 479
7 SASI_Rn02_00203450 predicted 540
8 SASI_Rn01_00105929 predicted 695
9 SASI_Rn01_00105930 predicted 892
10 SASI_Rn01_00105931 predicted 919
11 SASI_Rn01_00105928 predicted 481
12 SASI_Rn01_00105932 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033843 predicted 625
2 SASI_Mm01_00033844 predicted 688
3 SASI_Mm01_00033845 predicted 1045
4 SASI_Mm01_00033846 predicted 849
5 SASI_Mm01_00033847 predicted 225
6 SASI_Mm01_00033848 predicted 558
7 SASI_Mm01_00033849 predicted 435
8 SASI_Mm01_00033850 predicted 415
9 SASI_Mm01_00033851 predicted 263
10 SASI_Mm01_00033852 predicted 231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199136
VALIDATED
FAM221A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 221, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199136.3-653s21c1
Sequence:CCGGTGCAGCCATGGGAGGATTAACCTCGAGGTTAATCCTCCCATGGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199136.3-270s21c1
Sequence:CCGGCCAACAGGGATGGATTGTAAACTCGAGTTTACAATCCATCCCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199136.3-1107s21c1
Sequence:CCGGTTGGGATGTTTCCTTAATTTACTCGAGTAAATTAAGGAAACATCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199136.3-845s21c1
Sequence:CCGGTAGTCAAGTTTCTTCATTAAGCTCGAGCTTAATGAAGAAACTTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199136.1-453s1c1
Sequence:CCGGCCAAGTGTTCAGGATTCCATACTCGAGTATGGAATCCTGAACACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199136.1-465s1c1
Sequence:CCGGGATTCCATAGCTGCTTCACTTCTCGAGAAGTGAAGCAGCTATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199136.1-1120s1c1
Sequence:CCGGCCTTTCTTTCTCCTGACAAATCTCGAGATTTGTCAGGAGAAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199136.1-806s1c1
Sequence:CCGGGAGGATGATATGGCTTTCTTTCTCGAGAAAGAAAGCCATATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199136.1-746s1c1
Sequence:CCGGCCAGAAACGTTAACAGATGTACTCGAGTACATCTGTTAACGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199136
VALIDATED
FAM221A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 221, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199136.3-653s21c1
Sequence:CCGGTGCAGCCATGGGAGGATTAACCTCGAGGTTAATCCTCCCATGGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199136.3-270s21c1
Sequence:CCGGCCAACAGGGATGGATTGTAAACTCGAGTTTACAATCCATCCCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199136.3-1107s21c1
Sequence:CCGGTTGGGATGTTTCCTTAATTTACTCGAGTAAATTAAGGAAACATCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199136.3-845s21c1
Sequence:CCGGTAGTCAAGTTTCTTCATTAAGCTCGAGCTTAATGAAGAAACTTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199136.1-453s1c1
Sequence:CCGGCCAAGTGTTCAGGATTCCATACTCGAGTATGGAATCCTGAACACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199136.1-465s1c1
Sequence:CCGGGATTCCATAGCTGCTTCACTTCTCGAGAAGTGAAGCAGCTATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199136.1-1120s1c1
Sequence:CCGGCCTTTCTTTCTCCTGACAAATCTCGAGATTTGTCAGGAGAAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199136.1-806s1c1
Sequence:CCGGGAGGATGATATGGCTTTCTTTCTCGAGAAAGAAAGCCATATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199136.1-746s1c1
Sequence:CCGGCCAGAAACGTTAACAGATGTACTCGAGTACATCTGTTAACGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199136
VALIDATED
FAM221A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 221, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199136.3-653s21c1
Sequence:CCGGTGCAGCCATGGGAGGATTAACCTCGAGGTTAATCCTCCCATGGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199136.3-270s21c1
Sequence:CCGGCCAACAGGGATGGATTGTAAACTCGAGTTTACAATCCATCCCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199136.3-1107s21c1
Sequence:CCGGTTGGGATGTTTCCTTAATTTACTCGAGTAAATTAAGGAAACATCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199136.3-845s21c1
Sequence:CCGGTAGTCAAGTTTCTTCATTAAGCTCGAGCTTAATGAAGAAACTTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199136.1-453s1c1
Sequence:CCGGCCAAGTGTTCAGGATTCCATACTCGAGTATGGAATCCTGAACACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199136.1-465s1c1
Sequence:CCGGGATTCCATAGCTGCTTCACTTCTCGAGAAGTGAAGCAGCTATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199136.1-1120s1c1
Sequence:CCGGCCTTTCTTTCTCCTGACAAATCTCGAGATTTGTCAGGAGAAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199136.1-806s1c1
Sequence:CCGGGAGGATGATATGGCTTTCTTTCTCGAGAAAGAAAGCCATATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199136.1-746s1c1
Sequence:CCGGCCAGAAACGTTAACAGATGTACTCGAGTACATCTGTTAACGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172727
FAM221A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 221, member A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172727.2-227s21c1
Sequence:CCGGGCGTTTACAGAACAGATTATTCTCGAGAATAATCTGTTCTGTAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172727.2-403s21c1
Sequence:CCGGGGTGCAAGGCTTACCACTATGCTCGAGCATAGTGGTAAGCCTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172727.2-646s21c1
Sequence:CCGGATGCGGCAATGGGAGGTTTAACTCGAGTTAAACCTCCCATTGCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172727.2-1199s21c1
Sequence:CCGGTGGCGTTGGGATCACGGTATTCTCGAGAATACCGTGATCCCAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172727.2-310s21c1
Sequence:CCGGTTTGTACCCATAGGTATAAACCTCGAGGTTTATACCTATGGGTACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172727.1-490s1c1
Sequence:CCGGGCTCTTGGCTTCACATGCAATCTCGAGATTGCATGTGAAGCCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172727.1-880s1c1
Sequence:CCGGGAGGATGATATGGCATACTTTCTCGAGAAAGTATGCCATATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172727
FAM221A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 221, member A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172727.2-227s21c1
Sequence:CCGGGCGTTTACAGAACAGATTATTCTCGAGAATAATCTGTTCTGTAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172727.2-403s21c1
Sequence:CCGGGGTGCAAGGCTTACCACTATGCTCGAGCATAGTGGTAAGCCTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172727.2-646s21c1
Sequence:CCGGATGCGGCAATGGGAGGTTTAACTCGAGTTAAACCTCCCATTGCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172727.2-1199s21c1
Sequence:CCGGTGGCGTTGGGATCACGGTATTCTCGAGAATACCGTGATCCCAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172727.2-310s21c1
Sequence:CCGGTTTGTACCCATAGGTATAAACCTCGAGGTTTATACCTATGGGTACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172727.1-490s1c1
Sequence:CCGGGCTCTTGGCTTCACATGCAATCTCGAGATTGCATGTGAAGCCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172727.1-880s1c1
Sequence:CCGGGAGGATGATATGGCATACTTTCTCGAGAAAGTATGCCATATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172727
FAM221A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 221, member A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172727.2-227s21c1
Sequence:CCGGGCGTTTACAGAACAGATTATTCTCGAGAATAATCTGTTCTGTAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172727.2-403s21c1
Sequence:CCGGGGTGCAAGGCTTACCACTATGCTCGAGCATAGTGGTAAGCCTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172727.2-646s21c1
Sequence:CCGGATGCGGCAATGGGAGGTTTAACTCGAGTTAAACCTCCCATTGCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172727.2-1199s21c1
Sequence:CCGGTGGCGTTGGGATCACGGTATTCTCGAGAATACCGTGATCCCAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172727.2-310s21c1
Sequence:CCGGTTTGTACCCATAGGTATAAACCTCGAGGTTTATACCTATGGGTACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172727.1-490s1c1
Sequence:CCGGGCTCTTGGCTTCACATGCAATCTCGAGATTGCATGTGAAGCCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172727.1-880s1c1
Sequence:CCGGGAGGATGATATGGCATACTTTCTCGAGAAAGTATGCCATATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks