EMAIL THIS PAGE TO A FRIEND

FAM221B

family with sequence similarity 221, member B

52 Gene Product Result for
Synonyms: C9orf128
UniProtKB ID: A6H8Z2, Q5TCW2
Gene ID:
Mouse(242408) family with sequence similarity 221, member B
Rat(298398) family with sequence similarity 221, member B
sheep(101112285) family with sequence similarity 221, member B
domestic guinea pig(100729174) family with sequence similarity 221, member B
naked mole-rat(101714175) family with sequence similarity 221, member B
dog(474763) family with sequence similarity 221, member B
cow(783189) family with sequence similarity 221, member B
domestic cat(101094797) family with sequence similarity 221, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012446 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175517 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175517 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175517 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103321 MISSION® esiRNA esiRNA human C9orf128 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012446 Rosetta Predictions human pricing
NM_001013934 Rosetta Predictions rat pricing
NM_175517 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026027 predicted 1025
2 SASI_Hs01_00026028 predicted 368
3 SASI_Hs01_00026029 predicted 289
4 SASI_Hs01_00026031 predicted 1205
5 SASI_Hs02_00306148 predicted 1207
6 SASI_Hs02_00306149 predicted 366
7 SASI_Hs01_00026033 predicted 1192
8 SASI_Hs01_00026034 predicted 874
9 SASI_Hs01_00026035 predicted 1149
10 SASI_Hs01_00026036 predicted 558
11 SASI_Hs01_00026030 predicted 961
12 SASI_Hs01_00026032 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087406 predicted 463
2 SASI_Rn01_00087407 predicted 757
3 SASI_Rn01_00087408 predicted 559
4 SASI_Rn01_00087409 predicted 843
5 SASI_Rn02_00201238 predicted 1251
6 SASI_Rn01_00087411 predicted 475
7 SASI_Rn01_00087412 predicted 393
8 SASI_Rn01_00087413 predicted 618
9 SASI_Rn01_00087414 predicted 496
10 SASI_Rn02_00201239 predicted 451
11 SASI_Rn01_00087410 predicted 1135
12 SASI_Rn01_00087415 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082890 predicted 676
2 SASI_Mm01_00082891 predicted 552
3 SASI_Mm02_00346445 predicted 586
4 SASI_Mm01_00082892 predicted 1355
5 SASI_Mm01_00082893 predicted 624
6 SASI_Mm01_00082894 predicted 1501
7 SASI_Mm01_00082895 predicted 307
8 SASI_Mm01_00082897 predicted 619
9 SASI_Mm01_00082898 predicted 603
10 SASI_Mm01_00082896 predicted 1519
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012446
FAM221B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 221, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012446.1-1195s1c1
Sequence:CCGGGCTTTAGATCCTGACAGACTACTCGAGTAGTCTGTCAGGATCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012446.1-943s1c1
Sequence:CCGGGCAATGCATAGAGAGGAGTTTCTCGAGAAACTCCTCTCTATGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012446.1-1363s1c1
Sequence:CCGGGCTGCTTCATGTTCTGCTTTACTCGAGTAAAGCAGAACATGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012446.1-370s21c1
Sequence:CCGGGACTTACAGGAGAACCATATCCTCGAGGATATGGTTCTCCTGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012446.1-547s21c1
Sequence:CCGGCCTACCTATGAGGCTTCATTGCTCGAGCAATGAAGCCTCATAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012446.1-1365s21c1
Sequence:CCGGTGCTTCATGTTCTGCTTTATCCTCGAGGATAAAGCAGAACATGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012446.1-1090s21c1
Sequence:CCGGTACCTTGCTCTCTCAACAAAGCTCGAGCTTTGTTGAGAGAGCAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012446.1-1210s21c1
Sequence:CCGGAGACTATGGGTCTCTACATTGCTCGAGCAATGTAGAGACCCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012446
FAM221B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 221, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012446.1-1195s1c1
Sequence:CCGGGCTTTAGATCCTGACAGACTACTCGAGTAGTCTGTCAGGATCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012446.1-943s1c1
Sequence:CCGGGCAATGCATAGAGAGGAGTTTCTCGAGAAACTCCTCTCTATGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012446.1-1363s1c1
Sequence:CCGGGCTGCTTCATGTTCTGCTTTACTCGAGTAAAGCAGAACATGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012446.1-370s21c1
Sequence:CCGGGACTTACAGGAGAACCATATCCTCGAGGATATGGTTCTCCTGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012446.1-547s21c1
Sequence:CCGGCCTACCTATGAGGCTTCATTGCTCGAGCAATGAAGCCTCATAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012446.1-1365s21c1
Sequence:CCGGTGCTTCATGTTCTGCTTTATCCTCGAGGATAAAGCAGAACATGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012446.1-1090s21c1
Sequence:CCGGTACCTTGCTCTCTCAACAAAGCTCGAGCTTTGTTGAGAGAGCAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012446.1-1210s21c1
Sequence:CCGGAGACTATGGGTCTCTACATTGCTCGAGCAATGTAGAGACCCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012446
FAM221B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 221, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012446.1-1195s1c1
Sequence:CCGGGCTTTAGATCCTGACAGACTACTCGAGTAGTCTGTCAGGATCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012446.1-943s1c1
Sequence:CCGGGCAATGCATAGAGAGGAGTTTCTCGAGAAACTCCTCTCTATGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012446.1-1363s1c1
Sequence:CCGGGCTGCTTCATGTTCTGCTTTACTCGAGTAAAGCAGAACATGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012446.1-370s21c1
Sequence:CCGGGACTTACAGGAGAACCATATCCTCGAGGATATGGTTCTCCTGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012446.1-547s21c1
Sequence:CCGGCCTACCTATGAGGCTTCATTGCTCGAGCAATGAAGCCTCATAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012446.1-1365s21c1
Sequence:CCGGTGCTTCATGTTCTGCTTTATCCTCGAGGATAAAGCAGAACATGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012446.1-1090s21c1
Sequence:CCGGTACCTTGCTCTCTCAACAAAGCTCGAGCTTTGTTGAGAGAGCAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012446.1-1210s21c1
Sequence:CCGGAGACTATGGGTCTCTACATTGCTCGAGCAATGTAGAGACCCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175517
FAM221B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 221, member B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175517.2-312s1c1
Sequence:CCGGGCAAAGGAACAGCCTTCTTTACTCGAGTAAAGAAGGCTGTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175517.2-619s1c1
Sequence:CCGGGCTATGACAGTCCTATCTCTACTCGAGTAGAGATAGGACTGTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175517.3-1500s21c1
Sequence:CCGGAGGGCCCAATGTCGCTGTAAACTCGAGTTTACAGCGACATTGGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175517.3-621s21c1
Sequence:CCGGTATGACAGTCCTATCTCTAAACTCGAGTTTAGAGATAGGACTGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175517.3-995s1c1
Sequence:CCGGCAAGGAGGACGAATCTACAAACTCGAGTTTGTAGATTCGTCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175517.3-662s21c1
Sequence:CCGGGCTCTCACCAACAGCCAATATCTCGAGATATTGGCTGTTGGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175517.3-1278s21c1
Sequence:CCGGTGGCGCTGCCCGCATTATTTACTCGAGTAAATAATGCGGGCAGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175517.3-801s21c1
Sequence:CCGGGTCTCGTCAACAGCCAATATCCTCGAGGATATTGGCTGTTGACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175517
FAM221B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 221, member B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175517.2-312s1c1
Sequence:CCGGGCAAAGGAACAGCCTTCTTTACTCGAGTAAAGAAGGCTGTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175517.2-619s1c1
Sequence:CCGGGCTATGACAGTCCTATCTCTACTCGAGTAGAGATAGGACTGTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175517.3-1500s21c1
Sequence:CCGGAGGGCCCAATGTCGCTGTAAACTCGAGTTTACAGCGACATTGGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175517.3-621s21c1
Sequence:CCGGTATGACAGTCCTATCTCTAAACTCGAGTTTAGAGATAGGACTGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175517.3-995s1c1
Sequence:CCGGCAAGGAGGACGAATCTACAAACTCGAGTTTGTAGATTCGTCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175517.3-662s21c1
Sequence:CCGGGCTCTCACCAACAGCCAATATCTCGAGATATTGGCTGTTGGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175517.3-1278s21c1
Sequence:CCGGTGGCGCTGCCCGCATTATTTACTCGAGTAAATAATGCGGGCAGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175517.3-801s21c1
Sequence:CCGGGTCTCGTCAACAGCCAATATCCTCGAGGATATTGGCTGTTGACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175517
FAM221B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 221, member B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175517.2-312s1c1
Sequence:CCGGGCAAAGGAACAGCCTTCTTTACTCGAGTAAAGAAGGCTGTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175517.2-619s1c1
Sequence:CCGGGCTATGACAGTCCTATCTCTACTCGAGTAGAGATAGGACTGTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175517.3-1500s21c1
Sequence:CCGGAGGGCCCAATGTCGCTGTAAACTCGAGTTTACAGCGACATTGGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175517.3-621s21c1
Sequence:CCGGTATGACAGTCCTATCTCTAAACTCGAGTTTAGAGATAGGACTGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175517.3-995s1c1
Sequence:CCGGCAAGGAGGACGAATCTACAAACTCGAGTTTGTAGATTCGTCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175517.3-662s21c1
Sequence:CCGGGCTCTCACCAACAGCCAATATCTCGAGATATTGGCTGTTGGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175517.3-1278s21c1
Sequence:CCGGTGGCGCTGCCCGCATTATTTACTCGAGTAAATAATGCGGGCAGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175517.3-801s21c1
Sequence:CCGGGTCTCGTCAACAGCCAATATCCTCGAGGATATTGGCTGTTGACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks