EMAIL THIS PAGE TO A FRIEND

FAM222B

family with sequence similarity 222, member B

161 Gene Product Result for
Synonyms: C17orf63
UniProtKB ID: Q8WU58, Q9H6F3, Q9NVJ4, Q9NXN6
Gene ID:
Mouse(216971) family with sequence similarity 222, member B
Rat(497960) family with sequence similarity 222, member B
domestic cat(101095696) family with sequence similarity 222, member B
dog(610626) family with sequence similarity 222, member B
sheep(101107713) family with sequence similarity 222, member B
domestic guinea pig(100722257) family with sequence similarity 222, member B
naked mole-rat(101717360) family with sequence similarity 222, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018182 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077498 Rosetta Predictions human pricing
NM_018182 Rosetta Predictions human pricing
NM_001109038 Rosetta Predictions rat pricing
NM_145430 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312844 predicted 1706
2 SASI_Hs02_00312845 predicted 1300
3 SASI_Hs02_00312846 predicted 1929
4 SASI_Hs02_00312847 predicted 1711
5 SASI_Hs02_00312848 predicted 388
6 SASI_Hs02_00312849 predicted 1992
7 SASI_Hs02_00312850 predicted 1706
8 SASI_Hs02_00312851 predicted 1992
9 SASI_Hs02_00312852 predicted 2319
10 SASI_Hs02_00312853 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245582 predicted 1744
2 SASI_Hs01_00245584 predicted 1335
3 SASI_Hs01_00245587 predicted 1966
4 SASI_Hs01_00245589 predicted 1741
5 SASI_Hs01_00245591 predicted 423
6 SASI_Hs02_00351442 predicted 2020
7 SASI_Hs02_00351443 predicted 1737
8 SASI_Hs02_00351444 predicted 2023
9 SASI_Hs02_00351445 predicted 2357
10 SASI_Hs02_00351446 predicted 1006
11 SASI_Hs01_00245583 predicted 343
12 SASI_Hs01_00245585 predicted 307
13 SASI_Hs01_00245586 predicted 317
14 SASI_Hs01_00245588 predicted 331
15 SASI_Hs01_00245590 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109038 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244564 predicted 269
2 SASI_Rn02_00244565 predicted 1858
3 SASI_Rn02_00244566 predicted 285
4 SASI_Rn02_00244567 predicted 293
5 SASI_Rn02_00244568 predicted 259
6 SASI_Rn02_00244569 predicted 292
7 SASI_Rn02_00244570 predicted 346
8 SASI_Rn02_00244571 predicted 1955
9 SASI_Rn02_00244572 predicted 1871
10 SASI_Rn02_00244573 predicted 1951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127432 predicted 287
2 SASI_Mm01_00127433 predicted 295
3 SASI_Mm01_00127434 predicted 315
4 SASI_Mm01_00127435 predicted 1903
5 SASI_Mm01_00127436 predicted 1797
6 SASI_Mm01_00127439 predicted 362
7 SASI_Mm01_00127440 predicted 1876
8 SASI_Mm01_00127441 predicted 1240
9 SASI_Mm02_00340789 predicted 1521
10 SASI_Mm02_00340790 predicted 1111
11 SASI_Mm01_00127437 predicted 393
12 SASI_Mm01_00127438 predicted 417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145430
VALIDATED
FAM222B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 222, member B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145430.1-341s1c1
Sequence:CCGGGAAATGGGACACTACACAGAACTCGAGTTCTGTGTAGTGTCCCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145430.1-420s1c1
Sequence:CCGGGCAAACAACCCACTGACTATACTCGAGTATAGTCAGTGGGTTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145430.1-1909s1c1
Sequence:CCGGCAGATAGTCGAAGTCTTCATACTCGAGTATGAAGACTTCGACTATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145430.2-1806s21c1
Sequence:CCGGAGATAGTCGAAGTCTTCATATCTCGAGATATGAAGACTTCGACTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145430.2-1687s21c1
Sequence:CCGGTTGATGCAAACGGTGGATTACCTCGAGGTAATCCACCGTTTGCATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145430.2-1055s21c1
Sequence:CCGGGTCGCAGTCTGCTCATCAATGCTCGAGCATTGATGAGCAGACTGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145430.2-3280s1c1
Sequence:CCGGGCAACACGAAGTCCTAATTTACTCGAGTAAATTAGGACTTCGTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145430.2-886s21c1
Sequence:CCGGACCGTGTCTACCTCAACTATCCTCGAGGATAGTTGAGGTAGACACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145430.2-3403s21c1
Sequence:CCGGACCTCCGCTAGCCACTTATTTCTCGAGAAATAAGTGGCTAGCGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145430
VALIDATED
FAM222B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 222, member B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145430.1-341s1c1
Sequence:CCGGGAAATGGGACACTACACAGAACTCGAGTTCTGTGTAGTGTCCCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145430.1-420s1c1
Sequence:CCGGGCAAACAACCCACTGACTATACTCGAGTATAGTCAGTGGGTTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145430.1-1909s1c1
Sequence:CCGGCAGATAGTCGAAGTCTTCATACTCGAGTATGAAGACTTCGACTATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145430.2-1806s21c1
Sequence:CCGGAGATAGTCGAAGTCTTCATATCTCGAGATATGAAGACTTCGACTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145430.2-1687s21c1
Sequence:CCGGTTGATGCAAACGGTGGATTACCTCGAGGTAATCCACCGTTTGCATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145430.2-1055s21c1
Sequence:CCGGGTCGCAGTCTGCTCATCAATGCTCGAGCATTGATGAGCAGACTGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145430.2-3280s1c1
Sequence:CCGGGCAACACGAAGTCCTAATTTACTCGAGTAAATTAGGACTTCGTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145430.2-886s21c1
Sequence:CCGGACCGTGTCTACCTCAACTATCCTCGAGGATAGTTGAGGTAGACACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145430.2-3403s21c1
Sequence:CCGGACCTCCGCTAGCCACTTATTTCTCGAGAAATAAGTGGCTAGCGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145430
VALIDATED
FAM222B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 222, member B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145430.1-341s1c1
Sequence:CCGGGAAATGGGACACTACACAGAACTCGAGTTCTGTGTAGTGTCCCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145430.1-420s1c1
Sequence:CCGGGCAAACAACCCACTGACTATACTCGAGTATAGTCAGTGGGTTGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145430.1-1909s1c1
Sequence:CCGGCAGATAGTCGAAGTCTTCATACTCGAGTATGAAGACTTCGACTATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145430.2-1806s21c1
Sequence:CCGGAGATAGTCGAAGTCTTCATATCTCGAGATATGAAGACTTCGACTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145430.2-1687s21c1
Sequence:CCGGTTGATGCAAACGGTGGATTACCTCGAGGTAATCCACCGTTTGCATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145430.2-1055s21c1
Sequence:CCGGGTCGCAGTCTGCTCATCAATGCTCGAGCATTGATGAGCAGACTGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145430.2-3280s1c1
Sequence:CCGGGCAACACGAAGTCCTAATTTACTCGAGTAAATTAGGACTTCGTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145430.2-886s21c1
Sequence:CCGGACCGTGTCTACCTCAACTATCCTCGAGGATAGTTGAGGTAGACACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145430.2-3403s21c1
Sequence:CCGGACCTCCGCTAGCCACTTATTTCTCGAGAAATAAGTGGCTAGCGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018182
VALIDATED
FAM222B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 222, member B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018182.1-988s1c1
Sequence:CCGGGTGCACCAGATCAACCAGTTTCTCGAGAAACTGGTTGATCTGGTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018182.1-1082s1c1
Sequence:CCGGGCAGTCTGCTCATCAATGCAACTCGAGTTGCATTGATGAGCAGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018182.1-312s1c1
Sequence:CCGGCGAATTGGATGCGTATGCTAACTCGAGTTAGCATACGCATCCAATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018182.1-254s1c1
Sequence:CCGGGACTTCAGAAATGGGACACTACTCGAGTAGTGTCCCATTTCTGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018182.1-324s1c1
Sequence:CCGGGTATGCTAAGAAGGTCGCAAACTCGAGTTTGCGACCTTCTTAGCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018182.1-1700s1c1
Sequence:CCGGGCCAGAACAGCTTGATGCAAACTCGAGTTTGCATCAAGCTGTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018182.1-492s1c1
Sequence:CCGGCATTGTCAAAGTGCCAGCCAACTCGAGTTGGCTGGCACTTTGACAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018182.2-1021s21c1
Sequence:CCGGGTGCACCAGATCAACCAGTTTCTCGAGAAACTGGTTGATCTGGTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018182.2-1733s21c1
Sequence:CCGGGCCAGAACAGCTTGATGCAAACTCGAGTTTGCATCAAGCTGTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018182.2-357s21c1
Sequence:CCGGGTATGCTAAGAAGGTCGCAAACTCGAGTTTGCGACCTTCTTAGCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018182.2-345s21c1
Sequence:CCGGCGAATTGGATGCGTATGCTAACTCGAGTTAGCATACGCATCCAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018182.2-525s21c1
Sequence:CCGGCATTGTCAAAGTGCCAGCCAACTCGAGTTGGCTGGCACTTTGACAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018182
VALIDATED
FAM222B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 222, member B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018182.1-988s1c1
Sequence:CCGGGTGCACCAGATCAACCAGTTTCTCGAGAAACTGGTTGATCTGGTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018182.1-1082s1c1
Sequence:CCGGGCAGTCTGCTCATCAATGCAACTCGAGTTGCATTGATGAGCAGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018182.1-312s1c1
Sequence:CCGGCGAATTGGATGCGTATGCTAACTCGAGTTAGCATACGCATCCAATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018182.1-254s1c1
Sequence:CCGGGACTTCAGAAATGGGACACTACTCGAGTAGTGTCCCATTTCTGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018182.1-324s1c1
Sequence:CCGGGTATGCTAAGAAGGTCGCAAACTCGAGTTTGCGACCTTCTTAGCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018182.1-1700s1c1
Sequence:CCGGGCCAGAACAGCTTGATGCAAACTCGAGTTTGCATCAAGCTGTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018182.1-492s1c1
Sequence:CCGGCATTGTCAAAGTGCCAGCCAACTCGAGTTGGCTGGCACTTTGACAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018182.2-1021s21c1
Sequence:CCGGGTGCACCAGATCAACCAGTTTCTCGAGAAACTGGTTGATCTGGTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018182.2-1733s21c1
Sequence:CCGGGCCAGAACAGCTTGATGCAAACTCGAGTTTGCATCAAGCTGTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018182.2-357s21c1
Sequence:CCGGGTATGCTAAGAAGGTCGCAAACTCGAGTTTGCGACCTTCTTAGCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018182.2-345s21c1
Sequence:CCGGCGAATTGGATGCGTATGCTAACTCGAGTTAGCATACGCATCCAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018182.2-525s21c1
Sequence:CCGGCATTGTCAAAGTGCCAGCCAACTCGAGTTGGCTGGCACTTTGACAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018182
VALIDATED
FAM222B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 222, member B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018182.1-988s1c1
Sequence:CCGGGTGCACCAGATCAACCAGTTTCTCGAGAAACTGGTTGATCTGGTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018182.1-1082s1c1
Sequence:CCGGGCAGTCTGCTCATCAATGCAACTCGAGTTGCATTGATGAGCAGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018182.1-312s1c1
Sequence:CCGGCGAATTGGATGCGTATGCTAACTCGAGTTAGCATACGCATCCAATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018182.1-254s1c1
Sequence:CCGGGACTTCAGAAATGGGACACTACTCGAGTAGTGTCCCATTTCTGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018182.1-324s1c1
Sequence:CCGGGTATGCTAAGAAGGTCGCAAACTCGAGTTTGCGACCTTCTTAGCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018182.1-1700s1c1
Sequence:CCGGGCCAGAACAGCTTGATGCAAACTCGAGTTTGCATCAAGCTGTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018182.1-492s1c1
Sequence:CCGGCATTGTCAAAGTGCCAGCCAACTCGAGTTGGCTGGCACTTTGACAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018182.2-1021s21c1
Sequence:CCGGGTGCACCAGATCAACCAGTTTCTCGAGAAACTGGTTGATCTGGTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018182.2-1733s21c1
Sequence:CCGGGCCAGAACAGCTTGATGCAAACTCGAGTTTGCATCAAGCTGTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018182.2-357s21c1
Sequence:CCGGGTATGCTAAGAAGGTCGCAAACTCGAGTTTGCGACCTTCTTAGCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018182.2-345s21c1
Sequence:CCGGCGAATTGGATGCGTATGCTAACTCGAGTTAGCATACGCATCCAATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018182.2-525s21c1
Sequence:CCGGCATTGTCAAAGTGCCAGCCAACTCGAGTTGGCTGGCACTTTGACAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)