EMAIL THIS PAGE TO A FRIEND

FAM226A

family with sequence similarity 226, member A (non-protein coding)

33 Gene Product Result for
Synonyms: CXorf50 LINC00246A NCRNA00246 NCRNA00246A
Species: Human FAM226A(203429)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152693 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU223311 MISSION® esiRNA esiRNA targeting human NCRNA00246 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152693 Rosetta Predictions human pricing
XR_039969 Rosetta Predictions human pricing
XR_039970 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125151 predicted 929
2 SASI_Hs01_00125152 predicted 1218
3 SASI_Hs01_00125153 predicted 1061
4 SASI_Hs01_00125154 predicted 1209
5 SASI_Hs01_00125155 predicted 886
6 SASI_Hs01_00125156 predicted 610
7 SASI_Hs01_00125157 predicted 881
8 SASI_Hs01_00125158 predicted 680
9 SASI_Hs01_00125159 predicted 685
10 SASI_Hs01_00125160 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514721 predicted 1201
2 SASI_Hs02_00514722 predicted 1488
3 SASI_Hs02_00514723 predicted 1322
4 SASI_Hs02_00514724 predicted 1109
5 SASI_Hs02_00514725 predicted 1146
6 SASI_Hs02_00514726 predicted 1141
7 SASI_Hs02_00514727 predicted 946
8 SASI_Hs02_00514728 predicted 941
9 SASI_Hs02_00514729 predicted 1328
10 SASI_Hs02_00514730 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514731 predicted 1194
2 SASI_Hs02_00514732 predicted 1486
3 SASI_Hs02_00514733 predicted 1331
4 SASI_Hs02_00514734 predicted 1111
5 SASI_Hs02_00514735 predicted 1147
6 SASI_Hs02_00514736 predicted 1143
7 SASI_Hs02_00514737 predicted 940
8 SASI_Hs02_00514738 predicted 943
9 SASI_Hs02_00514739 predicted 1327
10 SASI_Hs02_00514740 predicted 1029
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152693
FAM226A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 226, member A (non-protein coding)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-699s1c1
Sequence:CCGGGATTACTCTGGACTCGATCTTCTCGAGAAGATCGAGTCCAGAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-573s1c1
Sequence:CCGGCTTTGGGTTCTATCTGAAGGACTCGAGTCCTTCAGATAGAACCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-612s1c1
Sequence:CCGGCTCCTATGTCTTGATCAGAAACTCGAGTTTCTGATCAAGACATAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-565s1c1
Sequence:CCGGGAGTTAGTCTTTGGGTTCTATCTCGAGATAGAACCCAAAGACTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-771s1c1
Sequence:CCGGGTTGGAGGCACATTTCGTCTACTCGAGTAGACGAAATGTGCCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-586s1c1
Sequence:CCGGCTGAAGGAACTTGATCCAGCACTCGAGTGCTGGATCAAGTTCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152693
FAM226A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 226, member A (non-protein coding)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-699s1c1
Sequence:CCGGGATTACTCTGGACTCGATCTTCTCGAGAAGATCGAGTCCAGAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-573s1c1
Sequence:CCGGCTTTGGGTTCTATCTGAAGGACTCGAGTCCTTCAGATAGAACCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-612s1c1
Sequence:CCGGCTCCTATGTCTTGATCAGAAACTCGAGTTTCTGATCAAGACATAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-565s1c1
Sequence:CCGGGAGTTAGTCTTTGGGTTCTATCTCGAGATAGAACCCAAAGACTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-771s1c1
Sequence:CCGGGTTGGAGGCACATTTCGTCTACTCGAGTAGACGAAATGTGCCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-586s1c1
Sequence:CCGGCTGAAGGAACTTGATCCAGCACTCGAGTGCTGGATCAAGTTCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152693
FAM226A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 226, member A (non-protein coding)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-699s1c1
Sequence:CCGGGATTACTCTGGACTCGATCTTCTCGAGAAGATCGAGTCCAGAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-573s1c1
Sequence:CCGGCTTTGGGTTCTATCTGAAGGACTCGAGTCCTTCAGATAGAACCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-612s1c1
Sequence:CCGGCTCCTATGTCTTGATCAGAAACTCGAGTTTCTGATCAAGACATAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-565s1c1
Sequence:CCGGGAGTTAGTCTTTGGGTTCTATCTCGAGATAGAACCCAAAGACTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-771s1c1
Sequence:CCGGGTTGGAGGCACATTTCGTCTACTCGAGTAGACGAAATGTGCCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152693.2-586s1c1
Sequence:CCGGCTGAAGGAACTTGATCCAGCACTCGAGTGCTGGATCAAGTTCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks