EMAIL THIS PAGE TO A FRIEND

FAM227A

family with sequence similarity 227, member A

104 Gene Product Result for
UniProtKB ID: F5H4B4, B7Z7C6
Gene ID:
Mouse(75729) family with sequence similarity 227, member A
Rat(300074) family with sequence similarity 227, member A
cow(100297485) family with sequence similarity 227, member A
domestic cat(101095836) family with sequence similarity 227, member A
dog(610126) family with sequence similarity 227, member A
naked mole-rat(101723567) family with sequence similarity 227, member A
sheep(101121929) family with sequence similarity 227, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718235 Rosetta Predictions human pricing
XM_001719507 Rosetta Predictions human pricing
XM_929809 Rosetta Predictions human pricing
XM_001063710 Rosetta Predictions rat pricing
XM_001076604 Rosetta Predictions rat pricing
XM_001479490 Rosetta Predictions mouse pricing
XM_128197 Rosetta Predictions mouse pricing
XM_901172 Rosetta Predictions mouse pricing
XM_992282 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00422371 predicted 835
2 SASI_Hs02_00422372 predicted 2159
3 SASI_Hs02_00422373 predicted 1479
4 SASI_Hs02_00422374 predicted 1362
5 SASI_Hs02_00422375 predicted 749
6 SASI_Hs02_00422376 predicted 1762
7 SASI_Hs02_00422377 predicted 1184
8 SASI_Hs02_00422378 predicted 1834
9 SASI_Hs02_00422379 predicted 1821
10 SASI_Hs02_00422380 predicted 1920
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00430903 predicted 612
2 SASI_Hs02_00430904 predicted 1939
3 SASI_Hs02_00430905 predicted 1260
4 SASI_Hs02_00430906 predicted 1144
5 SASI_Hs02_00430907 predicted 521
6 SASI_Hs02_00430908 predicted 1539
7 SASI_Hs02_00430909 predicted 960
8 SASI_Hs02_00430910 predicted 1614
9 SASI_Hs02_00430911 predicted 1601
10 SASI_Hs02_00430912 predicted 1702
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00481121 predicted 830
2 SASI_Hs02_00481122 predicted 2157
3 SASI_Hs02_00481123 predicted 1485
4 SASI_Hs02_00481124 predicted 1362
5 SASI_Hs02_00481125 predicted 741
6 SASI_Hs01_00267562 predicted 1759
7 SASI_Hs02_00481126 predicted 1176
8 SASI_Hs01_00267564 predicted 1835
9 SASI_Hs01_00267569 predicted 1817
10 SASI_Hs02_00481127 predicted 1912
11 SASI_Hs01_00267560 predicted 418
12 SASI_Hs01_00267561 predicted 428
13 SASI_Hs01_00267563 predicted 545
14 SASI_Hs01_00267565 predicted 578
15 SASI_Hs01_00267566 predicted 648
16 SASI_Hs01_00267567 predicted 538
17 SASI_Hs01_00267568 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308080 predicted 639
2 SASI_Rn02_00308081 predicted 637
3 SASI_Rn02_00308082 predicted 718
4 SASI_Rn02_00308083 predicted 688
5 SASI_Rn02_00308084 predicted 684
6 SASI_Rn02_00308085 predicted 790
7 SASI_Rn02_00308086 predicted 870
8 SASI_Rn02_00308087 predicted 814
9 SASI_Rn02_00308088 predicted 790
10 SASI_Rn02_00308089 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353853 predicted 754
2 SASI_Rn02_00353854 predicted 1046
3 SASI_Rn02_00353855 predicted 1319
4 SASI_Rn02_00353856 predicted 810
5 SASI_Rn02_00353857 predicted 1138
6 SASI_Rn02_00353858 predicted 1119
7 SASI_Rn02_00353859 predicted 795
8 SASI_Rn02_00353860 predicted 496
9 SASI_Rn02_00353861 predicted 909
10 SASI_Rn02_00353862 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00410363 predicted 1479
2 SASI_Mm02_00410364 predicted 225
3 SASI_Mm02_00410365 predicted 511
4 SASI_Mm02_00410366 predicted 1056
5 SASI_Mm02_00410367 predicted 1733
6 SASI_Mm02_00410368 predicted 1824
7 SASI_Mm02_00410369 predicted 1863
8 SASI_Mm02_00410370 predicted 676
9 SASI_Mm02_00410371 predicted 920
10 SASI_Mm02_00410372 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253933 predicted 1620
2 SASI_Mm01_00253934 predicted 394
3 SASI_Mm01_00253935 predicted 1083
4 SASI_Mm01_00253936 predicted 663
5 SASI_Mm01_00253937 predicted 1693
6 SASI_Mm01_00253938 predicted 529
7 SASI_Mm01_00253939 predicted 830
8 SASI_Mm01_00253940 predicted 839
9 SASI_Mm01_00253941 predicted 1601
10 SASI_Mm01_00253942 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270806 predicted 1715
2 SASI_Mm01_00270807 predicted 1422
3 SASI_Mm01_00270808 predicted 1798
4 SASI_Mm01_00270809 predicted 1421
5 SASI_Mm01_00270810 predicted 1416
6 SASI_Mm01_00270811 predicted 1843
7 SASI_Mm01_00270812 predicted 1685
8 SASI_Mm01_00270813 predicted 1687
9 SASI_Mm01_00270814 predicted 1767
10 SASI_Mm01_00270815 predicted 1807
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992282 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00451040 predicted 1477
2 SASI_Mm02_00451041 predicted 222
3 SASI_Mm02_00451042 predicted 507
4 SASI_Mm02_00451043 predicted 1055
5 SASI_Mm02_00451044 predicted 1736
6 SASI_Mm02_00451045 predicted 1823
7 SASI_Mm02_00451046 predicted 1866
8 SASI_Mm02_00451047 predicted 671
9 SASI_Mm02_00451048 predicted 919
10 SASI_Mm02_00451049 predicted 684
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029407
FAM227A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 227, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029407.1-1079s21c1
Sequence:CCGGTATGAAGAGGCACTCTTAAAGCTCGAGCTTTAAGAGTGCCTCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029407.1-1024s21c1
Sequence:CCGGCGACCGAATAGCCCGAAATTACTCGAGTAATTTCGGGCTATTCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029407.1-611s21c1
Sequence:CCGGGAGTTGGAGAAGAAGTCTTTACTCGAGTAAAGACTTCTTCTCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029407.1-1992s21c1
Sequence:CCGGTTGAATCGTCTGGCAAGAAATCTCGAGATTTCTTGCCAGACGATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029407.1-2435s21c1
Sequence:CCGGCTCATCCATCAGACATTTATTCTCGAGAATAAATGTCTGATGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029407
FAM227A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 227, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029407.1-1079s21c1
Sequence:CCGGTATGAAGAGGCACTCTTAAAGCTCGAGCTTTAAGAGTGCCTCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029407.1-1024s21c1
Sequence:CCGGCGACCGAATAGCCCGAAATTACTCGAGTAATTTCGGGCTATTCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029407.1-611s21c1
Sequence:CCGGGAGTTGGAGAAGAAGTCTTTACTCGAGTAAAGACTTCTTCTCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029407.1-1992s21c1
Sequence:CCGGTTGAATCGTCTGGCAAGAAATCTCGAGATTTCTTGCCAGACGATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029407.1-2435s21c1
Sequence:CCGGCTCATCCATCAGACATTTATTCTCGAGAATAAATGTCTGATGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029407
FAM227A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 227, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029407.1-1079s21c1
Sequence:CCGGTATGAAGAGGCACTCTTAAAGCTCGAGCTTTAAGAGTGCCTCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029407.1-1024s21c1
Sequence:CCGGCGACCGAATAGCCCGAAATTACTCGAGTAATTTCGGGCTATTCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029407.1-611s21c1
Sequence:CCGGGAGTTGGAGAAGAAGTCTTTACTCGAGTAAAGACTTCTTCTCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029407.1-1992s21c1
Sequence:CCGGTTGAATCGTCTGGCAAGAAATCTCGAGATTTCTTGCCAGACGATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029407.1-2435s21c1
Sequence:CCGGCTCATCCATCAGACATTTATTCTCGAGAATAAATGTCTGATGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks