EMAIL THIS PAGE TO A FRIEND

FAM227B

family with sequence similarity 227, member B

62 Gene Product Result for
Synonyms: C15orf33
UniProtKB ID: Q96M60, Q86WS2
Gene ID:
Mouse(75823) family with sequence similarity 227, member B
Rat(296118) family with sequence similarity 227, member B
sheep(101109098) family with sequence similarity 227, member B
domestic guinea pig(100715146) family with sequence similarity 227, member B
naked mole-rat(101705201) family with sequence similarity 227, member B
chicken(101667798) family with sequence similarity 227, member B
chicken(101752060) family with sequence similarity 227, member B
dog(100684995) family with sequence similarity 227, member B
domestic cat(101084365) family with sequence similarity 227, member B
cow(616894) family with sequence similarity 227, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152647 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123161 MISSION® esiRNA esiRNA human C15orf33 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152647 Rosetta Predictions human pricing
NM_001013920 Rosetta Predictions rat pricing
NM_029455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208674 predicted 1297
2 SASI_Hs01_00208676 predicted 950
3 SASI_Hs01_00208678 predicted 1004
4 SASI_Hs01_00208679 predicted 1413
5 SASI_Hs01_00208680 predicted 1288
6 SASI_Hs02_00366542 predicted 1357
7 SASI_Hs01_00208681 predicted 908
8 SASI_Hs01_00208682 predicted 1044
9 SASI_Hs01_00208683 predicted 1342
10 SASI_Hs02_00366543 predicted 1267
11 SASI_Hs01_00208675 predicted 400
12 SASI_Hs01_00208677 predicted 1127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115033 predicted 758
2 SASI_Rn01_00115034 predicted 905
3 SASI_Rn01_00115035 predicted 548
4 SASI_Rn01_00115036 predicted 531
5 SASI_Rn01_00115038 predicted 1210
6 SASI_Rn02_00201209 predicted 435
7 SASI_Rn01_00115039 predicted 1317
8 SASI_Rn01_00115040 predicted 774
9 SASI_Rn01_00115041 predicted 1246
10 SASI_Rn02_00201210 predicted 461
11 SASI_Rn01_00115037 predicted 1359
12 SASI_Rn01_00115042 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335366 predicted 1039
2 SASI_Mm02_00335367 predicted 994
3 SASI_Mm02_00335368 predicted 728
4 SASI_Mm02_00335369 predicted 536
5 SASI_Mm02_00335370 predicted 1243
6 SASI_Mm02_00335371 predicted 619
7 SASI_Mm02_00335372 predicted 826
8 SASI_Mm02_00335373 predicted 450
9 SASI_Mm02_00335374 predicted 543
10 SASI_Mm02_00335375 predicted 654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152647
FAM227B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 227, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152647.2-1457s21c1
Sequence:CCGGGAGGTCAGAGTCCATTGATTTCTCGAGAAATCAATGGACTCTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152647.2-1417s21c1
Sequence:CCCGAGTACTGGTCCAGAGTTTAATCTCGAGATTAAACTCTGGACCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152647.1-1700s1c1
Sequence:CCGGCTACATAAACTGCGTTCCGAACTCGAGTTCGGAACGCAGTTTATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152647.1-1359s1c1
Sequence:CCGGCCATATCCAAGGAAGAATCAACTCGAGTTGATTCTTCCTTGGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152647.1-356s1c1
Sequence:CCGGCCTCCAAAGAGCATTGAAGAACTCGAGTTCTTCAATGCTCTTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152647.1-1344s1c1
Sequence:CCGGGAGCATATACGTTGCCCATATCTCGAGATATGGGCAACGTATATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152647.1-1655s1c1
Sequence:CCGGGCTACCAAGAAACCTCATGAACTCGAGTTCATGAGGTTTCTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152647.1-1073s1c1
Sequence:CCGGGCAACGTTCCATGAAGCATTTCTCGAGAAATGCTTCATGGAACGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152647
FAM227B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 227, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152647.2-1457s21c1
Sequence:CCGGGAGGTCAGAGTCCATTGATTTCTCGAGAAATCAATGGACTCTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152647.2-1417s21c1
Sequence:CCCGAGTACTGGTCCAGAGTTTAATCTCGAGATTAAACTCTGGACCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152647.1-1700s1c1
Sequence:CCGGCTACATAAACTGCGTTCCGAACTCGAGTTCGGAACGCAGTTTATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152647.1-1359s1c1
Sequence:CCGGCCATATCCAAGGAAGAATCAACTCGAGTTGATTCTTCCTTGGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152647.1-356s1c1
Sequence:CCGGCCTCCAAAGAGCATTGAAGAACTCGAGTTCTTCAATGCTCTTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152647.1-1344s1c1
Sequence:CCGGGAGCATATACGTTGCCCATATCTCGAGATATGGGCAACGTATATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152647.1-1655s1c1
Sequence:CCGGGCTACCAAGAAACCTCATGAACTCGAGTTCATGAGGTTTCTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152647.1-1073s1c1
Sequence:CCGGGCAACGTTCCATGAAGCATTTCTCGAGAAATGCTTCATGGAACGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152647
FAM227B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 227, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152647.2-1457s21c1
Sequence:CCGGGAGGTCAGAGTCCATTGATTTCTCGAGAAATCAATGGACTCTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152647.2-1417s21c1
Sequence:CCCGAGTACTGGTCCAGAGTTTAATCTCGAGATTAAACTCTGGACCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152647.1-1700s1c1
Sequence:CCGGCTACATAAACTGCGTTCCGAACTCGAGTTCGGAACGCAGTTTATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152647.1-1359s1c1
Sequence:CCGGCCATATCCAAGGAAGAATCAACTCGAGTTGATTCTTCCTTGGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152647.1-356s1c1
Sequence:CCGGCCTCCAAAGAGCATTGAAGAACTCGAGTTCTTCAATGCTCTTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152647.1-1344s1c1
Sequence:CCGGGAGCATATACGTTGCCCATATCTCGAGATATGGGCAACGTATATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152647.1-1655s1c1
Sequence:CCGGGCTACCAAGAAACCTCATGAACTCGAGTTCATGAGGTTTCTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152647.1-1073s1c1
Sequence:CCGGGCAACGTTCCATGAAGCATTTCTCGAGAAATGCTTCATGGAACGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks