EMAIL THIS PAGE TO A FRIEND

FAM228A

family with sequence similarity 228, member A

74 Gene Product Result for
Synonyms: C2orf84
UniProtKB ID: Q86W67
Gene ID:
Mouse(74855) family with sequence similarity 228, member A
Rat(313936) family with sequence similarity 228, member A
Zebrafish(569576) family with sequence similarity 228, member A
domestic cat(101096884) family with sequence similarity 228, member A
cow(768001) protein FAM228A
domestic guinea pig(101787599) family with sequence similarity 228, member A
sheep(101106753) family with sequence similarity 228, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029107 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029107 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029107 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001040710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040710 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026211 MISSION® esiRNA esiRNA human AC008073.8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040710 Rosetta Predictions human pricing
XM_926573 Rosetta Predictions human pricing
XM_931412 Rosetta Predictions human pricing
XM_931416 Rosetta Predictions human pricing
NM_001014074 Rosetta Predictions rat pricing
NM_029107 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309119 predicted 202
2 SASI_Hs02_00309120 predicted 858
3 SASI_Hs02_00309121 predicted 545
4 SASI_Hs02_00309122 predicted 490
5 SASI_Hs02_00309123 predicted 562
6 SASI_Hs02_00309124 predicted 398
7 SASI_Hs02_00309125 predicted 244
8 SASI_Hs02_00309126 predicted 467
9 SASI_Hs02_00309127 predicted 786
10 SASI_Hs02_00309128 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285630 predicted 209
2 SASI_Hs01_00285631 predicted 868
3 SASI_Hs01_00285632 predicted 546
4 SASI_Hs01_00285633 predicted 609
5 SASI_Hs01_00285634 predicted 569
6 SASI_Hs01_00285635 predicted 403
7 SASI_Hs01_00285636 predicted 254
8 SASI_Hs01_00285637 predicted 482
9 SASI_Hs01_00285638 predicted 800
10 SASI_Hs01_00285639 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283096 predicted 759
2 SASI_Hs01_00283097 predicted 654
3 SASI_Hs01_00283098 predicted 831
4 SASI_Hs01_00283099 predicted 467
5 SASI_Hs01_00283100 predicted 812
6 SASI_Hs01_00283101 predicted 781
7 SASI_Hs01_00283102 predicted 629
8 SASI_Hs01_00283103 predicted 787
9 SASI_Hs01_00283104 predicted 693
10 SASI_Hs01_00283105 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258449 predicted 215
2 SASI_Hs01_00258450 predicted 218
3 SASI_Hs01_00258451 predicted 400
4 SASI_Hs01_00258452 predicted 212
5 SASI_Hs01_00258453 predicted 252
6 SASI_Hs01_00258454 predicted 209
7 SASI_Hs01_00258455 predicted 247
8 SASI_Hs01_00258456 predicted 206
9 SASI_Hs01_00258457 predicted 284
10 SASI_Hs01_00258458 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059845 predicted 424
2 SASI_Rn01_00059846 predicted 484
3 SASI_Rn01_00059847 predicted 390
4 SASI_Rn01_00059848 predicted 684
5 SASI_Rn01_00059849 predicted 823
6 SASI_Rn01_00059850 predicted 610
7 SASI_Rn02_00201478 predicted 427
8 SASI_Rn01_00059853 predicted 574
9 SASI_Rn02_00201479 predicted 579
10 SASI_Rn01_00059854 predicted 629
11 SASI_Rn01_00059851 predicted 480
12 SASI_Rn01_00059852 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029107 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164675 predicted 594
2 SASI_Mm01_00164676 predicted 1173
3 SASI_Mm01_00164677 predicted 235
4 SASI_Mm01_00164678 predicted 1145
5 SASI_Mm01_00164679 predicted 405
6 SASI_Mm01_00164680 predicted 339
7 SASI_Mm01_00164681 predicted 497
8 SASI_Mm01_00164682 predicted 271
9 SASI_Mm01_00164683 predicted 1162
10 SASI_Mm01_00164684 predicted 567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029107
FAM228A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 228, member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029107.1-347s1c1
Sequence:CCGGGTGAAGAGATTGGATACATATCTCGAGATATGTATCCAATCTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029107.1-526s1c1
Sequence:CCGGGCAAACAAATAAACCGACTAACTCGAGTTAGTCGGTTTATTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029107.1-606s1c1
Sequence:CCGGGTTACCAACATGGCAGAGGAACTCGAGTTCCTCTGCCATGTTGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029107.1-503s1c1
Sequence:CCGGGTGAAATATGAACACTGCTTACTCGAGTAAGCAGTGTTCATATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029107.1-2603s1c1
Sequence:CCGGCCCATCCTTCTGGTTTCATTACTCGAGTAATGAAACCAGAAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029107.1-259s1c1
Sequence:CCGGGCCGGAGTCTGTTTCTTTAATCTCGAGATTAAAGAAACAGACTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029107.1-810s1c1
Sequence:CCGGCATTAAAGTCTCATCTGCCTACTCGAGTAGGCAGATGAGACTTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029107.1-552s1c1
Sequence:CCGGCTTCATCGTGTCTGTTTCAAACTCGAGTTTGAAACAGACACGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029107
FAM228A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 228, member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029107.1-347s1c1
Sequence:CCGGGTGAAGAGATTGGATACATATCTCGAGATATGTATCCAATCTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029107.1-526s1c1
Sequence:CCGGGCAAACAAATAAACCGACTAACTCGAGTTAGTCGGTTTATTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029107.1-606s1c1
Sequence:CCGGGTTACCAACATGGCAGAGGAACTCGAGTTCCTCTGCCATGTTGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029107.1-503s1c1
Sequence:CCGGGTGAAATATGAACACTGCTTACTCGAGTAAGCAGTGTTCATATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029107.1-2603s1c1
Sequence:CCGGCCCATCCTTCTGGTTTCATTACTCGAGTAATGAAACCAGAAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029107.1-259s1c1
Sequence:CCGGGCCGGAGTCTGTTTCTTTAATCTCGAGATTAAAGAAACAGACTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029107.1-810s1c1
Sequence:CCGGCATTAAAGTCTCATCTGCCTACTCGAGTAGGCAGATGAGACTTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029107.1-552s1c1
Sequence:CCGGCTTCATCGTGTCTGTTTCAAACTCGAGTTTGAAACAGACACGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029107
FAM228A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 228, member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029107.1-347s1c1
Sequence:CCGGGTGAAGAGATTGGATACATATCTCGAGATATGTATCCAATCTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029107.1-526s1c1
Sequence:CCGGGCAAACAAATAAACCGACTAACTCGAGTTAGTCGGTTTATTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029107.1-606s1c1
Sequence:CCGGGTTACCAACATGGCAGAGGAACTCGAGTTCCTCTGCCATGTTGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029107.1-503s1c1
Sequence:CCGGGTGAAATATGAACACTGCTTACTCGAGTAAGCAGTGTTCATATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029107.1-2603s1c1
Sequence:CCGGCCCATCCTTCTGGTTTCATTACTCGAGTAATGAAACCAGAAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029107.1-259s1c1
Sequence:CCGGGCCGGAGTCTGTTTCTTTAATCTCGAGATTAAAGAAACAGACTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029107.1-810s1c1
Sequence:CCGGCATTAAAGTCTCATCTGCCTACTCGAGTAGGCAGATGAGACTTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029107.1-552s1c1
Sequence:CCGGCTTCATCGTGTCTGTTTCAAACTCGAGTTTGAAACAGACACGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040710
FAM228A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 228, member A
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000269476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040710.1-207s21c1
Sequence:CCGGGCAGTATGTGCAATATTATTTCTCGAGAAATAATATTGCACATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040710.1-181s21c1
Sequence:CCGGTATTAGCTAGAGAAGACATTGCTCGAGCAATGTCTTCTCTAGCTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040710.1-1228s21c1
Sequence:CCGGTTTCAGCTCCTGGTCTATTTCCTCGAGGAAATAGACCAGGAGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040710.1-393s21c1
Sequence:CCGGAGCTCGCCCTACTTCACTTTCCTCGAGGAAAGTGAAGTAGGGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040710
FAM228A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 228, member A
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000269476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040710.1-207s21c1
Sequence:CCGGGCAGTATGTGCAATATTATTTCTCGAGAAATAATATTGCACATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040710.1-181s21c1
Sequence:CCGGTATTAGCTAGAGAAGACATTGCTCGAGCAATGTCTTCTCTAGCTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040710.1-1228s21c1
Sequence:CCGGTTTCAGCTCCTGGTCTATTTCCTCGAGGAAATAGACCAGGAGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040710.1-393s21c1
Sequence:CCGGAGCTCGCCCTACTTCACTTTCCTCGAGGAAAGTGAAGTAGGGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040710
FAM228A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 228, member A
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000269476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040710.1-207s21c1
Sequence:CCGGGCAGTATGTGCAATATTATTTCTCGAGAAATAATATTGCACATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040710.1-181s21c1
Sequence:CCGGTATTAGCTAGAGAAGACATTGCTCGAGCAATGTCTTCTCTAGCTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040710.1-1228s21c1
Sequence:CCGGTTTCAGCTCCTGGTCTATTTCCTCGAGGAAATAGACCAGGAGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040710.1-393s21c1
Sequence:CCGGAGCTCGCCCTACTTCACTTTCCTCGAGGAAAGTGAAGTAGGGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks