EMAIL THIS PAGE TO A FRIEND

FAM228B

family with sequence similarity 228, member B

64 Gene Product Result for
UniProtKB ID: P0C875
Gene ID:
Mouse(207921) family with sequence similarity 228, member B
Rat(100363146) family with sequence similarity 228, member B
sheep(101107005) family with sequence similarity 228, member B
domestic guinea pig(100718962) family with sequence similarity 228, member B
naked mole-rat(101708014) family with sequence similarity 228, member B
domestic cat(101097141) family with sequence similarity 228, member B
dog(610841) family with sequence similarity 228, member B
cow(100125925) family with sequence similarity 228, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198553 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU064871 MISSION® esiRNA esiRNA targeting mouse A830093I24Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198553 Rosetta Predictions human pricing
XR_040244 Rosetta Predictions human pricing
XR_040245 Rosetta Predictions human pricing
XR_040246 Rosetta Predictions human pricing
NM_175431 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154101 predicted 386
2 SASI_Hs01_00154102 predicted 287
3 SASI_Hs01_00154103 predicted 403
4 SASI_Hs01_00154104 predicted 1044
5 SASI_Hs01_00154105 predicted 945
6 SASI_Hs01_00154106 predicted 524
7 SASI_Hs01_00154107 predicted 260
8 SASI_Hs01_00154108 predicted 389
9 SASI_Hs01_00154109 predicted 451
10 SASI_Hs01_00154110 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517159 predicted 543
2 SASI_Hs02_00517160 predicted 554
3 SASI_Hs02_00517161 predicted 784
4 SASI_Hs02_00517162 predicted 565
5 SASI_Hs02_00517163 predicted 823
6 SASI_Hs02_00517164 predicted 540
7 SASI_Hs02_00517165 predicted 598
8 SASI_Hs02_00517166 predicted 609
9 SASI_Hs02_00517167 predicted 827
10 SASI_Hs02_00517168 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517169 predicted 536
2 SASI_Hs02_00517170 predicted 559
3 SASI_Hs02_00517171 predicted 782
4 SASI_Hs02_00517172 predicted 562
5 SASI_Hs02_00517173 predicted 822
6 SASI_Hs02_00517174 predicted 531
7 SASI_Hs02_00517175 predicted 604
8 SASI_Hs02_00517176 predicted 601
9 SASI_Hs02_00517177 predicted 827
10 SASI_Hs02_00517178 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517179 predicted 538
2 SASI_Hs02_00517180 predicted 553
3 SASI_Hs02_00517181 predicted 783
4 SASI_Hs02_00517182 predicted 562
5 SASI_Hs02_00517183 predicted 821
6 SASI_Hs02_00517184 predicted 539
7 SASI_Hs02_00517185 predicted 601
8 SASI_Hs02_00517186 predicted 602
9 SASI_Hs02_00517187 predicted 826
10 SASI_Hs02_00517188 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346308 predicted 292
2 SASI_Mm01_00097822 predicted 336
3 SASI_Mm02_00346309 predicted 648
4 SASI_Mm01_00097824 predicted 492
5 SASI_Mm02_00346310 predicted 486
6 SASI_Mm01_00097826 predicted 527
7 SASI_Mm01_00097823 predicted 645
8 SASI_Mm01_00097827 predicted 357
9 SASI_Mm02_00346311 predicted 411
10 SASI_Mm02_00346312 predicted 684
11 SASI_Mm01_00097825 predicted 957
12 SASI_Mm01_00097828 predicted 949
13 SASI_Mm01_00097829 predicted 899
14 SASI_Mm01_00097830 predicted 947
15 SASI_Mm01_00097831 predicted 1149
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175431
FAM228B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 228, member B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000192705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175431.2-467s1c1
Sequence:CCGGGCTAAAGAAGATACTGATGCACTCGAGTGCATCAGTATCTTCTTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175431.2-1644s1c1
Sequence:CCGGGCCATACTAATCTAGTTACTTCTCGAGAAGTAACTAGATTAGTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175431.2-711s1c1
Sequence:CCGGCAAATAAGAAGGGAAATGCATCTCGAGATGCATTTCCCTTCTTATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175431.2-473s1c1
Sequence:CCGGGAAGATACTGATGCAGCTGTTCTCGAGAACAGCTGCATCAGTATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175431
FAM228B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 228, member B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000192705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175431.2-467s1c1
Sequence:CCGGGCTAAAGAAGATACTGATGCACTCGAGTGCATCAGTATCTTCTTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175431.2-1644s1c1
Sequence:CCGGGCCATACTAATCTAGTTACTTCTCGAGAAGTAACTAGATTAGTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175431.2-711s1c1
Sequence:CCGGCAAATAAGAAGGGAAATGCATCTCGAGATGCATTTCCCTTCTTATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175431.2-473s1c1
Sequence:CCGGGAAGATACTGATGCAGCTGTTCTCGAGAACAGCTGCATCAGTATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175431
FAM228B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 228, member B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000192705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175431.2-467s1c1
Sequence:CCGGGCTAAAGAAGATACTGATGCACTCGAGTGCATCAGTATCTTCTTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175431.2-1644s1c1
Sequence:CCGGGCCATACTAATCTAGTTACTTCTCGAGAAGTAACTAGATTAGTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175431.2-711s1c1
Sequence:CCGGCAAATAAGAAGGGAAATGCATCTCGAGATGCATTTCCCTTCTTATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175431.2-473s1c1
Sequence:CCGGGAAGATACTGATGCAGCTGTTCTCGAGAACAGCTGCATCAGTATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198553
FAM228B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 228, member B
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-416s1c1
Sequence:CCGGGCACTTTATAACTCCAAACGACTCGAGTCGTTTGGAGTTATAAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-412s1c1
Sequence:CCGGCAAGGCACTTTATAACTCCAACTCGAGTTGGAGTTATAAAGTGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-117s1c1
Sequence:CCGGGAGGCAGCTATTCAATCAATACTCGAGTATTGATTGAATAGCTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198553.1-258s1c1
Sequence:CCGGCCATTTCATGACCCTTTGAAACTCGAGTTTCAAAGGGTCATGAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-443s1c1
Sequence:CCGGGAAACTGCCTACAAGATACATCTCGAGATGTATCTTGTAGGCAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-388s1c1
Sequence:CCGGCCAGATTCCCACAAATTTCTACTCGAGTAGAAATTTGTGGGAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198553.1-1601s1c1
Sequence:CCGGGCCCTCAATCTTACAGGGATTCTCGAGAATCCCTGTAAGATTGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-525s1c1
Sequence:CCGGCTGTGCTATCAGGAGGGAAATCTCGAGATTTCCCTCCTGATAGCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-513s1c1
Sequence:CCGGGAAAGAGAACCGCTGTGCTATCTCGAGATAGCACAGCGGTTCTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-242s1c1
Sequence:CCGGGAAGGTTACCATCCCACCATTCTCGAGAATGGTGGGATGGTAACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198553.1-651s1c1
Sequence:CCGGGAGTGGATACAAGCATGGCTTCTCGAGAAGCCATGCTTGTATCCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198553.1-318s1c1
Sequence:CCGGCTTCAGTGTGAGACTGGCAAACTCGAGTTTGCCAGTCTCACACTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-447s1c1
Sequence:CCGGCTGCCTACAAGATACATAGAACTCGAGTTCTATGTATCTTGTAGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198553.1-450s1c1
Sequence:CCGGCCTACAAGATACATAGAAAGTCTCGAGACTTTCTATGTATCTTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198553
FAM228B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 228, member B
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-416s1c1
Sequence:CCGGGCACTTTATAACTCCAAACGACTCGAGTCGTTTGGAGTTATAAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-412s1c1
Sequence:CCGGCAAGGCACTTTATAACTCCAACTCGAGTTGGAGTTATAAAGTGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-117s1c1
Sequence:CCGGGAGGCAGCTATTCAATCAATACTCGAGTATTGATTGAATAGCTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198553.1-258s1c1
Sequence:CCGGCCATTTCATGACCCTTTGAAACTCGAGTTTCAAAGGGTCATGAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-443s1c1
Sequence:CCGGGAAACTGCCTACAAGATACATCTCGAGATGTATCTTGTAGGCAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-388s1c1
Sequence:CCGGCCAGATTCCCACAAATTTCTACTCGAGTAGAAATTTGTGGGAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198553.1-1601s1c1
Sequence:CCGGGCCCTCAATCTTACAGGGATTCTCGAGAATCCCTGTAAGATTGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-525s1c1
Sequence:CCGGCTGTGCTATCAGGAGGGAAATCTCGAGATTTCCCTCCTGATAGCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-513s1c1
Sequence:CCGGGAAAGAGAACCGCTGTGCTATCTCGAGATAGCACAGCGGTTCTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-242s1c1
Sequence:CCGGGAAGGTTACCATCCCACCATTCTCGAGAATGGTGGGATGGTAACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198553.1-651s1c1
Sequence:CCGGGAGTGGATACAAGCATGGCTTCTCGAGAAGCCATGCTTGTATCCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198553.1-318s1c1
Sequence:CCGGCTTCAGTGTGAGACTGGCAAACTCGAGTTTGCCAGTCTCACACTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-447s1c1
Sequence:CCGGCTGCCTACAAGATACATAGAACTCGAGTTCTATGTATCTTGTAGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198553.1-450s1c1
Sequence:CCGGCCTACAAGATACATAGAAAGTCTCGAGACTTTCTATGTATCTTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198553
FAM228B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 228, member B
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-416s1c1
Sequence:CCGGGCACTTTATAACTCCAAACGACTCGAGTCGTTTGGAGTTATAAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-412s1c1
Sequence:CCGGCAAGGCACTTTATAACTCCAACTCGAGTTGGAGTTATAAAGTGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-117s1c1
Sequence:CCGGGAGGCAGCTATTCAATCAATACTCGAGTATTGATTGAATAGCTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198553.1-258s1c1
Sequence:CCGGCCATTTCATGACCCTTTGAAACTCGAGTTTCAAAGGGTCATGAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-443s1c1
Sequence:CCGGGAAACTGCCTACAAGATACATCTCGAGATGTATCTTGTAGGCAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-388s1c1
Sequence:CCGGCCAGATTCCCACAAATTTCTACTCGAGTAGAAATTTGTGGGAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198553.1-1601s1c1
Sequence:CCGGGCCCTCAATCTTACAGGGATTCTCGAGAATCCCTGTAAGATTGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-525s1c1
Sequence:CCGGCTGTGCTATCAGGAGGGAAATCTCGAGATTTCCCTCCTGATAGCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-513s1c1
Sequence:CCGGGAAAGAGAACCGCTGTGCTATCTCGAGATAGCACAGCGGTTCTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-242s1c1
Sequence:CCGGGAAGGTTACCATCCCACCATTCTCGAGAATGGTGGGATGGTAACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198553.1-651s1c1
Sequence:CCGGGAGTGGATACAAGCATGGCTTCTCGAGAAGCCATGCTTGTATCCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198553.1-318s1c1
Sequence:CCGGCTTCAGTGTGAGACTGGCAAACTCGAGTTTGCCAGTCTCACACTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198553.1-447s1c1
Sequence:CCGGCTGCCTACAAGATACATAGAACTCGAGTTCTATGTATCTTGTAGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198553.1-450s1c1
Sequence:CCGGCCTACAAGATACATAGAAAGTCTCGAGACTTTCTATGTATCTTGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)