EMAIL THIS PAGE TO A FRIEND

FAM229A

family with sequence similarity 229, member A

68 Gene Product Result for
UniProtKB ID: H3BQW9
Gene ID:
Mouse(68233) family with sequence similarity 229, member A
Rat(500554) family with sequence similarity 229, member A
chicken(101665101) family with sequence similarity 229, member A
chicken(101752220) family with sequence similarity 229, member A
naked mole-rat(101718001) family with sequence similarity 229, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085491 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085491 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085491 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001724365 Rosetta Predictions human pricing
XM_001724643 Rosetta Predictions human pricing
XM_001724939 Rosetta Predictions human pricing
NM_001109266 Rosetta Predictions rat pricing
NM_001085491 Rosetta Predictions mouse pricing
XM_485446 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00461277 predicted 697
2 SASI_Hs02_00461278 predicted 816
3 SASI_Hs02_00461279 predicted 607
4 SASI_Hs02_00461280 predicted 738
5 SASI_Hs02_00461281 predicted 434
6 SASI_Hs02_00461282 predicted 432
7 SASI_Hs02_00461283 predicted 706
8 SASI_Hs02_00461284 predicted 610
9 SASI_Hs02_00461285 predicted 459
10 SASI_Hs02_00461286 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00462898 predicted 694
2 SASI_Hs02_00462899 predicted 811
3 SASI_Hs02_00462900 predicted 607
4 SASI_Hs02_00462901 predicted 740
5 SASI_Hs02_00462902 predicted 425
6 SASI_Hs02_00462903 predicted 432
7 SASI_Hs02_00462904 predicted 705
8 SASI_Hs02_00462905 predicted 608
9 SASI_Hs02_00462906 predicted 454
10 SASI_Hs02_00462907 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00464466 predicted 699
2 SASI_Hs02_00464467 predicted 815
3 SASI_Hs02_00464468 predicted 611
4 SASI_Hs02_00464469 predicted 737
5 SASI_Hs02_00464470 predicted 434
6 SASI_Hs02_00464471 predicted 430
7 SASI_Hs02_00464472 predicted 709
8 SASI_Hs02_00464473 predicted 613
9 SASI_Hs02_00464474 predicted 458
10 SASI_Hs02_00464475 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246724 predicted 557
2 SASI_Rn02_00246725 predicted 247
3 SASI_Rn02_00246726 predicted 467
4 SASI_Rn02_00246727 predicted 463
5 SASI_Rn02_00246728 predicted 455
6 SASI_Rn02_00246729 predicted 462
7 SASI_Rn02_00246730 predicted 246
8 SASI_Rn02_00246731 predicted 558
9 SASI_Rn02_00246732 predicted 305
10 SASI_Rn02_00246733 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300512 predicted 258
2 SASI_Mm02_00300513 predicted 294
3 SASI_Mm02_00300514 predicted 260
4 SASI_Mm02_00300515 predicted 256
5 SASI_Mm02_00300516 predicted 250
6 SASI_Mm02_00300517 predicted 316
7 SASI_Mm02_00300518 predicted 250
8 SASI_Mm02_00300519 predicted 249
9 SASI_Mm02_00300520 predicted 255
10 SASI_Mm02_00300521 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220363 predicted 248
2 SASI_Mm01_00220364 predicted 297
3 SASI_Mm01_00220365 predicted 252
4 SASI_Mm01_00220366 predicted 252
5 SASI_Mm01_00220367 predicted 247
6 SASI_Mm01_00220368 predicted 305
7 SASI_Mm01_00220369 predicted 241
8 SASI_Mm01_00220370 predicted 252
9 SASI_Mm01_00220371 predicted 256
10 SASI_Mm01_00220372 predicted 249
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085491
FAM229A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 229, member A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000269045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085491.2-328s21c1
Sequence:CCGGACGCTGCTGCACGTGCCCATCCTCGAGGATGGGCACGTGCAGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085491.2-202s21c1
Sequence:CCGGCCCATTGAGGCCGGAGACTCCCTCGAGGGAGTCTCCGGCCTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085491.2-161s21c1
Sequence:CCGGTGGACATGAGTGCCCAGGAGACTCGAGTCTCCTGGGCACTCATGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085491.2-263s21c1
Sequence:CCGGAGCCTGTAGCTACGGATCAAACTCGAGTTTGATCCGTAGCTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085491
FAM229A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 229, member A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000269045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085491.2-328s21c1
Sequence:CCGGACGCTGCTGCACGTGCCCATCCTCGAGGATGGGCACGTGCAGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085491.2-202s21c1
Sequence:CCGGCCCATTGAGGCCGGAGACTCCCTCGAGGGAGTCTCCGGCCTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085491.2-161s21c1
Sequence:CCGGTGGACATGAGTGCCCAGGAGACTCGAGTCTCCTGGGCACTCATGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085491.2-263s21c1
Sequence:CCGGAGCCTGTAGCTACGGATCAAACTCGAGTTTGATCCGTAGCTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085491
FAM229A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 229, member A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000269045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085491.2-328s21c1
Sequence:CCGGACGCTGCTGCACGTGCCCATCCTCGAGGATGGGCACGTGCAGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085491.2-202s21c1
Sequence:CCGGCCCATTGAGGCCGGAGACTCCCTCGAGGGAGTCTCCGGCCTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085491.2-161s21c1
Sequence:CCGGTGGACATGAGTGCCCAGGAGACTCGAGTCTCCTGGGCACTCATGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085491.2-263s21c1
Sequence:CCGGAGCCTGTAGCTACGGATCAAACTCGAGTTTGATCCGTAGCTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks