EMAIL THIS PAGE TO A FRIEND

FAM229B

family with sequence similarity 229, member B

47 Gene Product Result for
Synonyms: C6orf225
UniProtKB ID: Q4G0N7, B8ZZ33
Gene ID:
Mouse(66337) family with sequence similarity 229, member B
Rat(100188933) family with sequence similarity 229, member B
cow(777592) protein FAM229B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183254 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183254 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183254 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001033564 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033564 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033564 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033564 Rosetta Predictions human pricing
NM_001134695 Rosetta Predictions rat pricing
NM_183254 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111118 predicted 462
2 SASI_Hs01_00111119 predicted 561
3 SASI_Hs01_00111120 predicted 1117
4 SASI_Hs01_00111122 predicted 618
5 SASI_Hs01_00111121 predicted 465
6 SASI_Hs01_00111123 predicted 1041
7 SASI_Hs01_00111124 predicted 946
8 SASI_Hs01_00111125 predicted 1084
9 SASI_Hs01_00111126 predicted 690
10 SASI_Hs01_00111127 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257979 predicted 378
2 SASI_Rn02_00257980 predicted 401
3 SASI_Rn02_00257981 predicted 407
4 SASI_Rn02_00257982 predicted 430
5 SASI_Rn02_00257983 predicted 435
6 SASI_Rn02_00257984 predicted 381
7 SASI_Rn02_00257985 predicted 447
8 SASI_Rn02_00257986 predicted 373
9 SASI_Rn02_00257987 predicted 379
10 SASI_Rn02_00257988 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105395 predicted 419
2 SASI_Mm01_00105396 predicted 422
3 SASI_Mm02_00350332 predicted 432
4 SASI_Mm01_00105399 predicted 474
5 SASI_Mm01_00105400 predicted 427
6 SASI_Mm02_00350333 predicted 504
7 SASI_Mm01_00105402 predicted 434
8 SASI_Mm02_00350334 predicted 479
9 SASI_Mm02_00350335 predicted 477
10 SASI_Mm02_00350336 predicted 387
11 SASI_Mm01_00105393 predicted 494
12 SASI_Mm01_00105394 predicted 458
13 SASI_Mm01_00105397 predicted 504
14 SASI_Mm01_00105398 predicted 501
15 SASI_Mm01_00105401 predicted 458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183254
FAM229B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 229, member B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183254.1-484s21c1
Sequence:CCGGGAAAGAGACGTCACCCAATAGCTCGAGCTATTGGGTGACGTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183254.1-448s21c1
Sequence:CCGGAGAATCAGGCCTGAGCTCTAGCTCGAGCTAGAGCTCAGGCCTGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183254.1-563s21c1
Sequence:CCGGGTCTATGCAACAATGAGAAAGCTCGAGCTTTCTCATTGTTGCATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183254.1-433s21c1
Sequence:CCGGCTCTTCAATTGAGCTAGAATCCTCGAGGATTCTAGCTCAATTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183254.1-525s1c1
Sequence:CCGGGAAGTCACTGCCTGACAATAACTCGAGTTATTGTCAGGCAGTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183254.1-538s1c1
Sequence:CCGGGACAATAACTGATGTTCCCATCTCGAGATGGGAACATCAGTTATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183254.1-548s1c1
Sequence:CCGGGATGTTCCCATCACTGTCTATCTCGAGATAGACAGTGATGGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183254.1-532s1c1
Sequence:CCGGCTGCCTGACAATAACTGATGTCTCGAGACATCAGTTATTGTCAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183254
FAM229B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 229, member B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183254.1-484s21c1
Sequence:CCGGGAAAGAGACGTCACCCAATAGCTCGAGCTATTGGGTGACGTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183254.1-448s21c1
Sequence:CCGGAGAATCAGGCCTGAGCTCTAGCTCGAGCTAGAGCTCAGGCCTGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183254.1-563s21c1
Sequence:CCGGGTCTATGCAACAATGAGAAAGCTCGAGCTTTCTCATTGTTGCATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183254.1-433s21c1
Sequence:CCGGCTCTTCAATTGAGCTAGAATCCTCGAGGATTCTAGCTCAATTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183254.1-525s1c1
Sequence:CCGGGAAGTCACTGCCTGACAATAACTCGAGTTATTGTCAGGCAGTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183254.1-538s1c1
Sequence:CCGGGACAATAACTGATGTTCCCATCTCGAGATGGGAACATCAGTTATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183254.1-548s1c1
Sequence:CCGGGATGTTCCCATCACTGTCTATCTCGAGATAGACAGTGATGGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183254.1-532s1c1
Sequence:CCGGCTGCCTGACAATAACTGATGTCTCGAGACATCAGTTATTGTCAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183254
FAM229B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 229, member B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183254.1-484s21c1
Sequence:CCGGGAAAGAGACGTCACCCAATAGCTCGAGCTATTGGGTGACGTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183254.1-448s21c1
Sequence:CCGGAGAATCAGGCCTGAGCTCTAGCTCGAGCTAGAGCTCAGGCCTGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183254.1-563s21c1
Sequence:CCGGGTCTATGCAACAATGAGAAAGCTCGAGCTTTCTCATTGTTGCATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183254.1-433s21c1
Sequence:CCGGCTCTTCAATTGAGCTAGAATCCTCGAGGATTCTAGCTCAATTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183254.1-525s1c1
Sequence:CCGGGAAGTCACTGCCTGACAATAACTCGAGTTATTGTCAGGCAGTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183254.1-538s1c1
Sequence:CCGGGACAATAACTGATGTTCCCATCTCGAGATGGGAACATCAGTTATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183254.1-548s1c1
Sequence:CCGGGATGTTCCCATCACTGTCTATCTCGAGATAGACAGTGATGGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183254.1-532s1c1
Sequence:CCGGCTGCCTGACAATAACTGATGTCTCGAGACATCAGTTATTGTCAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033564
VALIDATED
FAM229B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 229, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033564.1-477s1c1
Sequence:CCGGGATTCTTCAATTGAGCTGGAACTCGAGTTCCAGCTCAATTGAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182903    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033564.1-1245s1c1
Sequence:CCGGCCCAGATTGTTGGTTAAATATCTCGAGATATTTAACCAACAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033564.1-634s1c1
Sequence:CCGGCTGCACAAAGCAGCAAGGAAACTCGAGTTTCCTTGCTGCTTTGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001033564.1-586s1c1
Sequence:CCGGCAATAACTGATGTTCCCGTCACTCGAGTGACGGGAACATCAGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033564.1-1244s1c1
Sequence:CCGGGCCCAGATTGTTGGTTAAATACTCGAGTATTTAACCAACAATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033564
VALIDATED
FAM229B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 229, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033564.1-477s1c1
Sequence:CCGGGATTCTTCAATTGAGCTGGAACTCGAGTTCCAGCTCAATTGAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182903    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033564.1-1245s1c1
Sequence:CCGGCCCAGATTGTTGGTTAAATATCTCGAGATATTTAACCAACAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033564.1-634s1c1
Sequence:CCGGCTGCACAAAGCAGCAAGGAAACTCGAGTTTCCTTGCTGCTTTGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001033564.1-586s1c1
Sequence:CCGGCAATAACTGATGTTCCCGTCACTCGAGTGACGGGAACATCAGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033564.1-1244s1c1
Sequence:CCGGGCCCAGATTGTTGGTTAAATACTCGAGTATTTAACCAACAATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033564
VALIDATED
FAM229B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 229, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033564.1-477s1c1
Sequence:CCGGGATTCTTCAATTGAGCTGGAACTCGAGTTCCAGCTCAATTGAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182903    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033564.1-1245s1c1
Sequence:CCGGCCCAGATTGTTGGTTAAATATCTCGAGATATTTAACCAACAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033564.1-634s1c1
Sequence:CCGGCTGCACAAAGCAGCAAGGAAACTCGAGTTTCCTTGCTGCTTTGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001033564.1-586s1c1
Sequence:CCGGCAATAACTGATGTTCCCGTCACTCGAGTGACGGGAACATCAGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033564.1-1244s1c1
Sequence:CCGGGCCCAGATTGTTGGTTAAATACTCGAGTATTTAACCAACAATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks