EMAIL THIS PAGE TO A FRIEND

FAM230B

family with sequence similarity 230, member B

Species: Human FAM230B(284861)
Gene ID:
Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201565
FAM230B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 230, member B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-1198s1c1
Sequence:CCGGCCAACGAGCTGTATACGACATCTCGAGATGTCGTATACAGCTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164811    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-2312s1c1
Sequence:CCGGCGCTGTATATGGCATCGCTAACTCGAGTTAGCGATGCCATATACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164029    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-1550s1c1
Sequence:CCGGCGGGAGATATACCTAATGCTACTCGAGTAGCATTAGGTATATCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-2367s1c1
Sequence:CCGGGCTGTATATGACATTGCTAATCTCGAGATTAGCAATGTCATATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-2366s1c1
Sequence:CCGGCGCTGTATATGACATTGCTAACTCGAGTTAGCAATGTCATATACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164514    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-3220s1c1
Sequence:CCGGCCTCTGAACTTTCAGGACTTTCTCGAGAAAGTCCTGAAAGTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-3219s1c1
Sequence:CCGGGCCTCTGAACTTTCAGGACTTCTCGAGAAGTCCTGAAAGTTCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-1203s1c1
Sequence:CCGGGAGCTGTATACGACATCGCTACTCGAGTAGCGATGTCGTATACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-419s1c1
Sequence:CCGGCGAGGATACTGTACACGACATCTCGAGATGTCGTGTACAGTATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-423s1c1
Sequence:CCGGGATACTGTACACGACATCGCTCTCGAGAGCGATGTCGTGTACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-408s1c1
Sequence:CCGGGACATCGCTAACGAGGATACTCTCGAGAGTATCCTCGTTAGCGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-413s1c1
Sequence:CCGGCGCTAACGAGGATACTGTACACTCGAGTGTACAGTATCCTCGTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201565
FAM230B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 230, member B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-1198s1c1
Sequence:CCGGCCAACGAGCTGTATACGACATCTCGAGATGTCGTATACAGCTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164811    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-2312s1c1
Sequence:CCGGCGCTGTATATGGCATCGCTAACTCGAGTTAGCGATGCCATATACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164029    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-1550s1c1
Sequence:CCGGCGGGAGATATACCTAATGCTACTCGAGTAGCATTAGGTATATCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-2367s1c1
Sequence:CCGGGCTGTATATGACATTGCTAATCTCGAGATTAGCAATGTCATATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-2366s1c1
Sequence:CCGGCGCTGTATATGACATTGCTAACTCGAGTTAGCAATGTCATATACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164514    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-3220s1c1
Sequence:CCGGCCTCTGAACTTTCAGGACTTTCTCGAGAAAGTCCTGAAAGTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-3219s1c1
Sequence:CCGGGCCTCTGAACTTTCAGGACTTCTCGAGAAGTCCTGAAAGTTCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-1203s1c1
Sequence:CCGGGAGCTGTATACGACATCGCTACTCGAGTAGCGATGTCGTATACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-419s1c1
Sequence:CCGGCGAGGATACTGTACACGACATCTCGAGATGTCGTGTACAGTATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-423s1c1
Sequence:CCGGGATACTGTACACGACATCGCTCTCGAGAGCGATGTCGTGTACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-408s1c1
Sequence:CCGGGACATCGCTAACGAGGATACTCTCGAGAGTATCCTCGTTAGCGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-413s1c1
Sequence:CCGGCGCTAACGAGGATACTGTACACTCGAGTGTACAGTATCCTCGTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201565
FAM230B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 230, member B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-1198s1c1
Sequence:CCGGCCAACGAGCTGTATACGACATCTCGAGATGTCGTATACAGCTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164811    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-2312s1c1
Sequence:CCGGCGCTGTATATGGCATCGCTAACTCGAGTTAGCGATGCCATATACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164029    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-1550s1c1
Sequence:CCGGCGGGAGATATACCTAATGCTACTCGAGTAGCATTAGGTATATCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-2367s1c1
Sequence:CCGGGCTGTATATGACATTGCTAATCTCGAGATTAGCAATGTCATATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-2366s1c1
Sequence:CCGGCGCTGTATATGACATTGCTAACTCGAGTTAGCAATGTCATATACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164514    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-3220s1c1
Sequence:CCGGCCTCTGAACTTTCAGGACTTTCTCGAGAAAGTCCTGAAAGTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201565.1-3219s1c1
Sequence:CCGGGCCTCTGAACTTTCAGGACTTCTCGAGAAGTCCTGAAAGTTCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-1203s1c1
Sequence:CCGGGAGCTGTATACGACATCGCTACTCGAGTAGCGATGTCGTATACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-419s1c1
Sequence:CCGGCGAGGATACTGTACACGACATCTCGAGATGTCGTGTACAGTATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-423s1c1
Sequence:CCGGGATACTGTACACGACATCGCTCTCGAGAGCGATGTCGTGTACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-408s1c1
Sequence:CCGGGACATCGCTAACGAGGATACTCTCGAGAGTATCCTCGTTAGCGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201565.1-413s1c1
Sequence:CCGGCGCTAACGAGGATACTGTACACTCGAGTGTACAGTATCCTCGTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks