EMAIL THIS PAGE TO A FRIEND

FAM24A

family with sequence similarity 24, member A

57 Gene Product Result for
UniProtKB ID: A6NFZ4
Gene ID:
Mouse(68223) family with sequence similarity 24, member A
Rat(499278) family with sequence similarity 24, member A
dog(100683580) family with sequence similarity 24, member A
cow(783415) family with sequence similarity 24, member A
sheep(101112779) family with sequence similarity 24, member A
domestic guinea pig(101789369) family with sequence similarity 24, member A
naked mole-rat(101702021) family with sequence similarity 24, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029888 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183272 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183272 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183272 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029888 Rosetta Predictions human pricing
NM_001109158 Rosetta Predictions rat pricing
NM_183272 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031150 predicted 197
2 SASI_Hs01_00031151 predicted 377
3 SASI_Hs01_00031152 predicted 353
4 SASI_Hs01_00031153 predicted 330
5 SASI_Hs01_00031154 predicted 359
6 SASI_Hs01_00031155 predicted 362
7 SASI_Hs01_00031156 predicted 363
8 SASI_Hs01_00031157 predicted 367
9 SASI_Hs01_00031158 predicted 350
10 SASI_Hs01_00031149 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245700 predicted 231
2 SASI_Rn02_00245701 predicted 254
3 SASI_Rn02_00245702 predicted 296
4 SASI_Rn02_00245703 predicted 331
5 SASI_Rn02_00245704 predicted 336
6 SASI_Rn02_00245705 predicted 330
7 SASI_Rn02_00245706 predicted 239
8 SASI_Rn02_00245707 predicted 259
9 SASI_Rn02_00245708 predicted 290
10 SASI_Rn02_00245709 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038692 predicted 301
2 SASI_Mm01_00038693 predicted 78
3 SASI_Mm01_00038694 predicted 42
4 SASI_Mm01_00038695 predicted 144
5 SASI_Mm01_00038696 predicted 50
6 SASI_Mm01_00038697 predicted 109
7 SASI_Mm01_00038698 predicted 213
8 SASI_Mm01_00038699 predicted 294
9 SASI_Mm01_00038700 predicted 165
10 SASI_Mm01_00038701 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029888
FAM24A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 24, member A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-372s1c1
Sequence:CCGGGTTGTAGAATGCATGCCAGTTCTCGAGAACTGGCATGCATTCTACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-226s1c1
Sequence:CCGGCAAAGTAGCTAAGGCACTAAACTCGAGTTTAGTGCCTTAGCTACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-216s1c1
Sequence:CCGGGTCTTTACTTCAAAGTAGCTACTCGAGTAGCTACTTTGAAGTAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-209s1c1
Sequence:CCGGGTGTTCTGTCTTTACTTCAAACTCGAGTTTGAAGTAAAGACAGAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-199s1c1
Sequence:CCGGCCTAAGTGTTGTGTTCTGTCTCTCGAGAGACAGAACACAACACTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-405s1c1
Sequence:CCGGCACCTTGCTGTTGTGACATAACTCGAGTTATGTCACAACAGCAAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029888
FAM24A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 24, member A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-372s1c1
Sequence:CCGGGTTGTAGAATGCATGCCAGTTCTCGAGAACTGGCATGCATTCTACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-226s1c1
Sequence:CCGGCAAAGTAGCTAAGGCACTAAACTCGAGTTTAGTGCCTTAGCTACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-216s1c1
Sequence:CCGGGTCTTTACTTCAAAGTAGCTACTCGAGTAGCTACTTTGAAGTAAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-209s1c1
Sequence:CCGGGTGTTCTGTCTTTACTTCAAACTCGAGTTTGAAGTAAAGACAGAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-199s1c1
Sequence:CCGGCCTAAGTGTTGTGTTCTGTCTCTCGAGAGACAGAACACAACACTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-405s1c1
Sequence:CCGGCACCTTGCTGTTGTGACATAACTCGAGTTATGTCACAACAGCAAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029888
FAM24A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 24, member A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-372s1c1
Sequence:CCGGGTTGTAGAATGCATGCCAGTTCTCGAGAACTGGCATGCATTCTACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-226s1c1
Sequence:CCGGCAAAGTAGCTAAGGCACTAAACTCGAGTTTAGTGCCTTAGCTACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-216s1c1
Sequence:CCGGGTCTTTACTTCAAAGTAGCTACTCGAGTAGCTACTTTGAAGTAAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-209s1c1
Sequence:CCGGGTGTTCTGTCTTTACTTCAAACTCGAGTTTGAAGTAAAGACAGAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-199s1c1
Sequence:CCGGCCTAAGTGTTGTGTTCTGTCTCTCGAGAGACAGAACACAACACTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029888.1-405s1c1
Sequence:CCGGCACCTTGCTGTTGTGACATAACTCGAGTTATGTCACAACAGCAAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183272
FAM24A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 24, member A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183272.1-84s1c1
Sequence:CCGGCTGCTGATTGCTGCAATCATGCTCGAGCATGATTGCAGCAATCAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183272.1-117s1c1
Sequence:CCGGGTGTTCTGTCTTTACCAGAAACTCGAGTTTCTGGTAAAGACAGAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183272.1-169s1c1
Sequence:CCGGCTGAATGCTGTATTGATCCATCTCGAGATGGATCAATACAGCATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183272.1-101s1c1
Sequence:CCGGCATGCTGATAACGCTTGTGTTCTCGAGAACACAAGCGTTATCAGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183272
FAM24A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 24, member A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183272.1-84s1c1
Sequence:CCGGCTGCTGATTGCTGCAATCATGCTCGAGCATGATTGCAGCAATCAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183272.1-117s1c1
Sequence:CCGGGTGTTCTGTCTTTACCAGAAACTCGAGTTTCTGGTAAAGACAGAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183272.1-169s1c1
Sequence:CCGGCTGAATGCTGTATTGATCCATCTCGAGATGGATCAATACAGCATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183272.1-101s1c1
Sequence:CCGGCATGCTGATAACGCTTGTGTTCTCGAGAACACAAGCGTTATCAGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183272
FAM24A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 24, member A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183272.1-84s1c1
Sequence:CCGGCTGCTGATTGCTGCAATCATGCTCGAGCATGATTGCAGCAATCAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183272.1-117s1c1
Sequence:CCGGGTGTTCTGTCTTTACCAGAAACTCGAGTTTCTGGTAAAGACAGAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183272.1-169s1c1
Sequence:CCGGCTGAATGCTGTATTGATCCATCTCGAGATGGATCAATACAGCATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183272.1-101s1c1
Sequence:CCGGCATGCTGATAACGCTTGTGTTCTCGAGAACACAAGCGTTATCAGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)