EMAIL THIS PAGE TO A FRIEND

FAM24B

family with sequence similarity 24, member B

31 Gene Product Result for
Species: Human FAM24B(196792)
UniProtKB ID: Q8N5W8, Q5JPG1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152644 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152644 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204568 predicted 529
2 SASI_Hs01_00204569 predicted 524
3 SASI_Hs01_00204570 predicted 364
4 SASI_Hs01_00204571 predicted 373
5 SASI_Hs01_00204572 predicted 515
6 SASI_Hs01_00204573 predicted 381
7 SASI_Hs01_00204574 predicted 375
8 SASI_Hs01_00204575 predicted 466
9 SASI_Hs01_00204577 predicted 538
10 SASI_Hs02_00366541 predicted 534
11 SASI_Hs01_00204576 predicted 254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152644
VALIDATED
FAM24B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 24, member B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152644.1-467s1c1
Sequence:CCGGGTGAAGGATATAGAATGTGTGCTCGAGCACACATTCTATATCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152644.1-464s1c1
Sequence:CCGGGCTGTGAAGGATATAGAATGTCTCGAGACATTCTATATCCTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_152644.1-541s1c1
Sequence:CCGGGTTAGGAAAGGTGGGCACAAACTCGAGTTTGTGCCCACCTTTCCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152644.1-459s1c1
Sequence:CCGGGCAGTGCTGTGAAGGATATAGCTCGAGCTATATCCTTCACAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152644.1-300s1c1
Sequence:CCGGGATAGTTGTCGTGCTCTGTCTCTCGAGAGACAGAGCACGACAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152644.1-304s1c1
Sequence:CCGGGTTGTCGTGCTCTGTCTTTACCTCGAGGTAAAGACAGAGCACGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-509s21c1
Sequence:CCGGACCATTGCCACGGAGTCTTGTCTCGAGACAAGACTCCGTGGCAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-606s21c1
Sequence:CCGGATGAGGGCCTCTGAGTTAGGACTCGAGTCCTAACTCAGAGGCCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-573s21c1
Sequence:CCGGTTGATTCCCTGCCACCTTGCTCTCGAGAGCAAGGTGGCAGGGAATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-439s21c1
Sequence:CCGGACCTGAAGCTGTGGCTGTAAACTCGAGTTTACAGCCACAGCTTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-553s21c1
Sequence:CCGGATATAGAATGTGTGCCAGTTTCTCGAGAAACTGGCACACATTCTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-366s21c1
Sequence:CCGGCCTTGCTCCTGCTGATAGTTGCTCGAGCAACTATCAGCAGGAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152644
VALIDATED
FAM24B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 24, member B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152644.1-467s1c1
Sequence:CCGGGTGAAGGATATAGAATGTGTGCTCGAGCACACATTCTATATCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152644.1-464s1c1
Sequence:CCGGGCTGTGAAGGATATAGAATGTCTCGAGACATTCTATATCCTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_152644.1-541s1c1
Sequence:CCGGGTTAGGAAAGGTGGGCACAAACTCGAGTTTGTGCCCACCTTTCCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152644.1-459s1c1
Sequence:CCGGGCAGTGCTGTGAAGGATATAGCTCGAGCTATATCCTTCACAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152644.1-300s1c1
Sequence:CCGGGATAGTTGTCGTGCTCTGTCTCTCGAGAGACAGAGCACGACAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152644.1-304s1c1
Sequence:CCGGGTTGTCGTGCTCTGTCTTTACCTCGAGGTAAAGACAGAGCACGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-509s21c1
Sequence:CCGGACCATTGCCACGGAGTCTTGTCTCGAGACAAGACTCCGTGGCAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-606s21c1
Sequence:CCGGATGAGGGCCTCTGAGTTAGGACTCGAGTCCTAACTCAGAGGCCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-573s21c1
Sequence:CCGGTTGATTCCCTGCCACCTTGCTCTCGAGAGCAAGGTGGCAGGGAATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-439s21c1
Sequence:CCGGACCTGAAGCTGTGGCTGTAAACTCGAGTTTACAGCCACAGCTTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-553s21c1
Sequence:CCGGATATAGAATGTGTGCCAGTTTCTCGAGAAACTGGCACACATTCTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-366s21c1
Sequence:CCGGCCTTGCTCCTGCTGATAGTTGCTCGAGCAACTATCAGCAGGAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152644
VALIDATED
FAM24B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 24, member B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152644.1-467s1c1
Sequence:CCGGGTGAAGGATATAGAATGTGTGCTCGAGCACACATTCTATATCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152644.1-464s1c1
Sequence:CCGGGCTGTGAAGGATATAGAATGTCTCGAGACATTCTATATCCTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_152644.1-541s1c1
Sequence:CCGGGTTAGGAAAGGTGGGCACAAACTCGAGTTTGTGCCCACCTTTCCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152644.1-459s1c1
Sequence:CCGGGCAGTGCTGTGAAGGATATAGCTCGAGCTATATCCTTCACAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152644.1-300s1c1
Sequence:CCGGGATAGTTGTCGTGCTCTGTCTCTCGAGAGACAGAGCACGACAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152644.1-304s1c1
Sequence:CCGGGTTGTCGTGCTCTGTCTTTACCTCGAGGTAAAGACAGAGCACGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-509s21c1
Sequence:CCGGACCATTGCCACGGAGTCTTGTCTCGAGACAAGACTCCGTGGCAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-606s21c1
Sequence:CCGGATGAGGGCCTCTGAGTTAGGACTCGAGTCCTAACTCAGAGGCCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-573s21c1
Sequence:CCGGTTGATTCCCTGCCACCTTGCTCTCGAGAGCAAGGTGGCAGGGAATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-439s21c1
Sequence:CCGGACCTGAAGCTGTGGCTGTAAACTCGAGTTTACAGCCACAGCTTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-553s21c1
Sequence:CCGGATATAGAATGTGTGCCAGTTTCTCGAGAAACTGGCACACATTCTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152644.2-366s21c1
Sequence:CCGGCCTTGCTCCTGCTGATAGTTGCTCGAGCAACTATCAGCAGGAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks