EMAIL THIS PAGE TO A FRIEND

FAM25B

family with sequence similarity 25, member B

9 Gene Product Result for
Synonyms: FAM25A FAM25C FAM25G
Species: Human FAM25B(100132929)
UniProtKB ID: B3EWG4, B2RV02, Q5VTM1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001137556 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001137556 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001137556 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715142 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00401744 predicted 106
2 SASI_Hs02_00401745 predicted 100
3 SASI_Hs02_00401746 predicted 217
4 SASI_Hs02_00401747 predicted 272
5 SASI_Hs02_00401748 predicted 217
6 SASI_Hs02_00401749 predicted 269
7 SASI_Hs02_00401750 predicted 279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001137556
FAM25B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 25, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137556.1-114s21c1
Sequence:CCGGGAAGTGGTGAAGGAGGTGGTGCTCGAGCACCACCTCCTTCACCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137556.1-103s21c1
Sequence:CCGGATGCCGTGGAGGAAGTGGTGACTCGAGTCACCACTTCCTCCACGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137556.1-139s21c1
Sequence:CCGGATGCCAAGGAGACTGGAGAGACTCGAGTCTCTCCAGTCTCCTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137556.1-162s21c1
Sequence:CCGGGCCATTGCTGAAGCCATAAAGCTCGAGCTTTATGGCTTCAGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137556.1-150s21c1
Sequence:CCGGACTGGAGAGAAAGCCATTGCTCTCGAGAGCAATGGCTTTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001137556
FAM25B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 25, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137556.1-114s21c1
Sequence:CCGGGAAGTGGTGAAGGAGGTGGTGCTCGAGCACCACCTCCTTCACCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137556.1-103s21c1
Sequence:CCGGATGCCGTGGAGGAAGTGGTGACTCGAGTCACCACTTCCTCCACGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137556.1-139s21c1
Sequence:CCGGATGCCAAGGAGACTGGAGAGACTCGAGTCTCTCCAGTCTCCTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137556.1-162s21c1
Sequence:CCGGGCCATTGCTGAAGCCATAAAGCTCGAGCTTTATGGCTTCAGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137556.1-150s21c1
Sequence:CCGGACTGGAGAGAAAGCCATTGCTCTCGAGAGCAATGGCTTTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001137556
FAM25B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 25, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137556.1-114s21c1
Sequence:CCGGGAAGTGGTGAAGGAGGTGGTGCTCGAGCACCACCTCCTTCACCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137556.1-103s21c1
Sequence:CCGGATGCCGTGGAGGAAGTGGTGACTCGAGTCACCACTTCCTCCACGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137556.1-139s21c1
Sequence:CCGGATGCCAAGGAGACTGGAGAGACTCGAGTCTCTCCAGTCTCCTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137556.1-162s21c1
Sequence:CCGGGCCATTGCTGAAGCCATAAAGCTCGAGCTTTATGGCTTCAGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137556.1-150s21c1
Sequence:CCGGACTGGAGAGAAAGCCATTGCTCTCGAGAGCAATGGCTTTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks