EMAIL THIS PAGE TO A FRIEND

FAM25C

family with sequence similarity 25, member C

22 Gene Product Result for
Synonyms: FAM25A FAM25B FAM25G bA164N7.4
UniProtKB ID: B3EWG5, B2RV02, Q5VTM1
Gene ID:
Mouse(69134) family with sequence similarity 25, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001137548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001137548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001137548 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183278 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183278 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183278 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU161121 MISSION® esiRNA esiRNA targeting mouse Fam25c mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_927297 Rosetta Predictions human pricing
NM_183278 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297575 predicted 102
2 SASI_Hs01_00297569 predicted 97
3 SASI_Hs01_00297570 predicted 217
4 SASI_Hs01_00297571 predicted 270
5 SASI_Hs01_00297572 predicted 215
6 SASI_Hs01_00297573 predicted 276
7 SASI_Hs01_00297574 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170606 predicted 240
2 SASI_Mm01_00170607 predicted 149
3 SASI_Mm01_00170608 predicted 160
4 SASI_Mm01_00170609 predicted 245
5 SASI_Mm01_00170610 predicted 164
6 SASI_Mm01_00170611 predicted 161
7 SASI_Mm01_00170612 predicted 181
8 SASI_Mm01_00170613 predicted 322
9 SASI_Mm01_00170614 predicted 297
10 SASI_Mm01_00170615 predicted 321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001137548
FAM25C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 25, member C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137548.1-120s21c1
Sequence:CCGGGTGAAGGAGGTGGTGGGACATCTCGAGATGTCCCACCACCTCCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137548.1-163s21c1
Sequence:CCGGCCATTGCTGAAGCCATAAAGACTCGAGTCTTTATGGCTTCAGCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137548.1-137s21c1
Sequence:CCGGACATGCCAAGGAGACTGGAGACTCGAGTCTCCAGTCTCCTTGGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137548.1-98s21c1
Sequence:CCGGCATTCATGCCGTGGAGGAAGTCTCGAGACTTCCTCCACGGCATGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137548.1-148s21c1
Sequence:CCGGAGACTGGAGAGAAAGCCATTGCTCGAGCAATGGCTTTCTCTCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001137548
FAM25C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 25, member C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137548.1-120s21c1
Sequence:CCGGGTGAAGGAGGTGGTGGGACATCTCGAGATGTCCCACCACCTCCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137548.1-163s21c1
Sequence:CCGGCCATTGCTGAAGCCATAAAGACTCGAGTCTTTATGGCTTCAGCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137548.1-137s21c1
Sequence:CCGGACATGCCAAGGAGACTGGAGACTCGAGTCTCCAGTCTCCTTGGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137548.1-98s21c1
Sequence:CCGGCATTCATGCCGTGGAGGAAGTCTCGAGACTTCCTCCACGGCATGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137548.1-148s21c1
Sequence:CCGGAGACTGGAGAGAAAGCCATTGCTCGAGCAATGGCTTTCTCTCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001137548
FAM25C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 25, member C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137548.1-120s21c1
Sequence:CCGGGTGAAGGAGGTGGTGGGACATCTCGAGATGTCCCACCACCTCCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137548.1-163s21c1
Sequence:CCGGCCATTGCTGAAGCCATAAAGACTCGAGTCTTTATGGCTTCAGCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137548.1-137s21c1
Sequence:CCGGACATGCCAAGGAGACTGGAGACTCGAGTCTCCAGTCTCCTTGGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137548.1-98s21c1
Sequence:CCGGCATTCATGCCGTGGAGGAAGTCTCGAGACTTCCTCCACGGCATGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137548.1-148s21c1
Sequence:CCGGAGACTGGAGAGAAAGCCATTGCTCGAGCAATGGCTTTCTCTCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183278
FAM25C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 25, member C
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183278.2-185s21c1
Sequence:CCGGCCTAAAGAAAGCCCAAGAATCCTCGAGGATTCTTGGGCTTTCTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183278.2-104s21c1
Sequence:CCGGAGCAGTTCACGCAGTGGAAGACTCGAGTCTTCCACTGCGTGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183278.2-159s21c1
Sequence:CCGGGTTGGAGAGAAGGCCATTAATCTCGAGATTAATGGCCTTCTCTCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183278.2-170s21c1
Sequence:CCGGGGCCATTAATGACGCCCTAAACTCGAGTTTAGGGCGTCATTAATGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183278.2-194s21c1
Sequence:CCGGAGCCCAAGAATCAGGAGACAGCTCGAGCTGTCTCCTGATTCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183278.1-185s1c1
Sequence:CCGGCCTAAAGAAAGCCCAAGAATCCTCGAGGATTCTTGGGCTTTCTTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183278.1-172s1c1
Sequence:CCGGCCATTAATGACGCCCTAAAGACTCGAGTCTTTAGGGCGTCATTAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183278.1-191s1c1
Sequence:CCGGGAAAGCCCAAGAATCAGGAGACTCGAGTCTCCTGATTCTTGGGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183278
FAM25C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 25, member C
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183278.2-185s21c1
Sequence:CCGGCCTAAAGAAAGCCCAAGAATCCTCGAGGATTCTTGGGCTTTCTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183278.2-104s21c1
Sequence:CCGGAGCAGTTCACGCAGTGGAAGACTCGAGTCTTCCACTGCGTGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183278.2-159s21c1
Sequence:CCGGGTTGGAGAGAAGGCCATTAATCTCGAGATTAATGGCCTTCTCTCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183278.2-170s21c1
Sequence:CCGGGGCCATTAATGACGCCCTAAACTCGAGTTTAGGGCGTCATTAATGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183278.2-194s21c1
Sequence:CCGGAGCCCAAGAATCAGGAGACAGCTCGAGCTGTCTCCTGATTCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183278.1-185s1c1
Sequence:CCGGCCTAAAGAAAGCCCAAGAATCCTCGAGGATTCTTGGGCTTTCTTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183278.1-172s1c1
Sequence:CCGGCCATTAATGACGCCCTAAAGACTCGAGTCTTTAGGGCGTCATTAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183278.1-191s1c1
Sequence:CCGGGAAAGCCCAAGAATCAGGAGACTCGAGTCTCCTGATTCTTGGGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183278
FAM25C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 25, member C
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183278.2-185s21c1
Sequence:CCGGCCTAAAGAAAGCCCAAGAATCCTCGAGGATTCTTGGGCTTTCTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183278.2-104s21c1
Sequence:CCGGAGCAGTTCACGCAGTGGAAGACTCGAGTCTTCCACTGCGTGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183278.2-159s21c1
Sequence:CCGGGTTGGAGAGAAGGCCATTAATCTCGAGATTAATGGCCTTCTCTCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183278.2-170s21c1
Sequence:CCGGGGCCATTAATGACGCCCTAAACTCGAGTTTAGGGCGTCATTAATGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183278.2-194s21c1
Sequence:CCGGAGCCCAAGAATCAGGAGACAGCTCGAGCTGTCTCCTGATTCTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183278.1-185s1c1
Sequence:CCGGCCTAAAGAAAGCCCAAGAATCCTCGAGGATTCTTGGGCTTTCTTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183278.1-172s1c1
Sequence:CCGGCCATTAATGACGCCCTAAAGACTCGAGTCTTTAGGGCGTCATTAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183278.1-191s1c1
Sequence:CCGGGAAAGCCCAAGAATCAGGAGACTCGAGTCTCCTGATTCTTGGGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)