EMAIL THIS PAGE TO A FRIEND

FAM25G

family with sequence similarity 25, member G

10 Gene Product Result for
Synonyms: FAM25A FAM25B FAM25C bA301J7.4
Species: Human FAM25G(100133093)
UniProtKB ID: B3EWG6, B2RV02, Q5VTM1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001137549 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001137549 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001137549 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128881 MISSION® esiRNA esiRNA human FAM25G (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717003 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00414377 predicted 104
2 SASI_Hs02_00414378 predicted 102
3 SASI_Hs02_00414379 predicted 217
4 SASI_Hs02_00414380 predicted 276
5 SASI_Hs02_00414381 predicted 224
6 SASI_Hs02_00414382 predicted 274
7 SASI_Hs02_00414383 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001137549
FAM25G MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 25, member G
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000284136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137549.1-104s21c1
Sequence:CCGGTGCCGTGGAGGAAGTGGTGAACTCGAGTTCACCACTTCCTCCACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137549.1-142s21c1
Sequence:CCGGCCAAGGAGACTGGAGAGAAAGCTCGAGCTTTCTCTCCAGTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137549.1-153s21c1
Sequence:CCGGGGAGAGAAAGCCATTGCTGAACTCGAGTTCAGCAATGGCTTTCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137549.1-164s21c1
Sequence:CCGGCATTGCTGAAGCCATAAAGAACTCGAGTTCTTTATGGCTTCAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001137549
FAM25G MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 25, member G
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000284136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137549.1-104s21c1
Sequence:CCGGTGCCGTGGAGGAAGTGGTGAACTCGAGTTCACCACTTCCTCCACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137549.1-142s21c1
Sequence:CCGGCCAAGGAGACTGGAGAGAAAGCTCGAGCTTTCTCTCCAGTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137549.1-153s21c1
Sequence:CCGGGGAGAGAAAGCCATTGCTGAACTCGAGTTCAGCAATGGCTTTCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137549.1-164s21c1
Sequence:CCGGCATTGCTGAAGCCATAAAGAACTCGAGTTCTTTATGGCTTCAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001137549
FAM25G MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 25, member G
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000284136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137549.1-104s21c1
Sequence:CCGGTGCCGTGGAGGAAGTGGTGAACTCGAGTTCACCACTTCCTCCACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137549.1-142s21c1
Sequence:CCGGCCAAGGAGACTGGAGAGAAAGCTCGAGCTTTCTCTCCAGTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137549.1-153s21c1
Sequence:CCGGGGAGAGAAAGCCATTGCTGAACTCGAGTTCAGCAATGGCTTTCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137549.1-164s21c1
Sequence:CCGGCATTGCTGAAGCCATAAAGAACTCGAGTTCTTTATGGCTTCAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks