EMAIL THIS PAGE TO A FRIEND

FAM26D

family with sequence similarity 26, member D

70 Gene Product Result for
Synonyms: C6orf78
UniProtKB ID: Q5JW98, B0QZ25, B0QZ27, B4DTQ0, Q96MK0
Gene ID:
Mouse(270711) family with sequence similarity 26, member D
Rat(499445) family with sequence similarity 26, member D
chicken(421742) family with sequence similarity 26, member D
cow(529412) family with sequence similarity 26, member D
domestic cat(101089939) family with sequence similarity 26, member D
dog(612534) family with sequence similarity 26, member D
sheep(101105416) family with sequence similarity 26, member D
domestic guinea pig(100720689) family with sequence similarity 26, member D
naked mole-rat(101704551) family with sequence similarity 26, member D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153036 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081165 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081165 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081165 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153036 Rosetta Predictions human pricing
XM_001053163 Rosetta Predictions rat pricing
XM_574768 Rosetta Predictions rat pricing
NM_001081165 Rosetta Predictions mouse pricing
XM_194722 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184037 predicted 453
2 SASI_Hs01_00184038 predicted 478
3 SASI_Hs01_00184039 predicted 573
4 SASI_Hs01_00184041 predicted 552
5 SASI_Hs01_00184042 predicted 429
6 SASI_Hs01_00184044 predicted 493
7 SASI_Hs01_00184045 predicted 426
8 SASI_Hs02_00366990 predicted 623
9 SASI_Hs02_00366991 predicted 433
10 SASI_Hs02_00366992 predicted 560
11 SASI_Hs01_00184036 predicted 618
12 SASI_Hs01_00184040 predicted 627
13 SASI_Hs01_00184043 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053163 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271493 predicted 428
2 SASI_Rn02_00271494 predicted 704
3 SASI_Rn02_00271495 predicted 207
4 SASI_Rn02_00271496 predicted 472
5 SASI_Rn02_00271497 predicted 239
6 SASI_Rn02_00271498 predicted 642
7 SASI_Rn02_00271499 predicted 768
8 SASI_Rn02_00271500 predicted 599
9 SASI_Rn02_00271501 predicted 462
10 SASI_Rn02_00271502 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402550 predicted 581
2 SASI_Rn02_00402551 predicted 203
3 SASI_Rn02_00402552 predicted 271
4 SASI_Rn02_00402553 predicted 803
5 SASI_Rn02_00402554 predicted 916
6 SASI_Rn02_00402555 predicted 800
7 SASI_Rn02_00402556 predicted 268
8 SASI_Rn02_00402557 predicted 396
9 SASI_Rn02_00402558 predicted 747
10 SASI_Rn02_00402559 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081165 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295821 predicted 425
2 SASI_Mm02_00295822 predicted 1433
3 SASI_Mm02_00295823 predicted 799
4 SASI_Mm02_00295824 predicted 781
5 SASI_Mm02_00295825 predicted 576
6 SASI_Mm02_00295826 predicted 793
7 SASI_Mm02_00295827 predicted 511
8 SASI_Mm02_00295828 predicted 752
9 SASI_Mm02_00295829 predicted 545
10 SASI_Mm02_00295830 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_194722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263224 predicted 1443
2 SASI_Mm01_00263225 predicted 1415
3 SASI_Mm01_00263226 predicted 432
4 SASI_Mm01_00263227 predicted 825
5 SASI_Mm01_00263228 predicted 868
6 SASI_Mm01_00263229 predicted 808
7 SASI_Mm01_00263230 predicted 779
8 SASI_Mm01_00263231 predicted 583
9 SASI_Mm01_00263232 predicted 799
10 SASI_Mm01_00263233 predicted 510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153036
FAM26D MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 26, member D
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153036.2-773s21c1
Sequence:CCGCGTAAGTCCATCTCAAATATTACTCGAGTAATATTTGAGATGGACTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153036.2-446s21c1
Sequence:CCGGATCGCATAAAGAAGCTATTTGCTCGAGCAAATAGCTTCTTTATGCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153036.2-564s21c1
Sequence:CCGGTGACTTGCAAGGTCACTATAGCTCGAGCTATAGTGACCTTGCAAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136031    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153036.1-633s1c1
Sequence:CCGGGCTTAGCAGATACTTGGCTTTCTCGAGAAAGCCAAGTATCTGCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153036.1-559s1c1
Sequence:CCGGGAGGATAATGAGGAAGACAGACTCGAGTCTGTCTTCCTCATTATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153036.1-571s1c1
Sequence:CCGGGAAGACAGATCAAGAGGTATTCTCGAGAATACCTCTTGATCTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153036.1-1042s1c1
Sequence:CCGGCCATGTCTTCTATTCACCATTCTCGAGAATGGTGAATAGAAGACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153036.1-336s1c1
Sequence:CCGGCCAGAATGAGAGAGAACTCTTCTCGAGAAGAGTTCTCTCTCATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153036
FAM26D MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 26, member D
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153036.2-773s21c1
Sequence:CCGCGTAAGTCCATCTCAAATATTACTCGAGTAATATTTGAGATGGACTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153036.2-446s21c1
Sequence:CCGGATCGCATAAAGAAGCTATTTGCTCGAGCAAATAGCTTCTTTATGCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153036.2-564s21c1
Sequence:CCGGTGACTTGCAAGGTCACTATAGCTCGAGCTATAGTGACCTTGCAAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136031    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153036.1-633s1c1
Sequence:CCGGGCTTAGCAGATACTTGGCTTTCTCGAGAAAGCCAAGTATCTGCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153036.1-559s1c1
Sequence:CCGGGAGGATAATGAGGAAGACAGACTCGAGTCTGTCTTCCTCATTATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153036.1-571s1c1
Sequence:CCGGGAAGACAGATCAAGAGGTATTCTCGAGAATACCTCTTGATCTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153036.1-1042s1c1
Sequence:CCGGCCATGTCTTCTATTCACCATTCTCGAGAATGGTGAATAGAAGACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153036.1-336s1c1
Sequence:CCGGCCAGAATGAGAGAGAACTCTTCTCGAGAAGAGTTCTCTCTCATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153036
FAM26D MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 26, member D
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153036.2-773s21c1
Sequence:CCGCGTAAGTCCATCTCAAATATTACTCGAGTAATATTTGAGATGGACTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153036.2-446s21c1
Sequence:CCGGATCGCATAAAGAAGCTATTTGCTCGAGCAAATAGCTTCTTTATGCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153036.2-564s21c1
Sequence:CCGGTGACTTGCAAGGTCACTATAGCTCGAGCTATAGTGACCTTGCAAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136031    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153036.1-633s1c1
Sequence:CCGGGCTTAGCAGATACTTGGCTTTCTCGAGAAAGCCAAGTATCTGCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153036.1-559s1c1
Sequence:CCGGGAGGATAATGAGGAAGACAGACTCGAGTCTGTCTTCCTCATTATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153036.1-571s1c1
Sequence:CCGGGAAGACAGATCAAGAGGTATTCTCGAGAATACCTCTTGATCTGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153036.1-1042s1c1
Sequence:CCGGCCATGTCTTCTATTCACCATTCTCGAGAATGGTGAATAGAAGACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153036.1-336s1c1
Sequence:CCGGCCAGAATGAGAGAGAACTCTTCTCGAGAAGAGTTCTCTCTCATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081165
FAM26D MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 26, member D
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081165.1-688s21c1
Sequence:CCGGCCTCTCTGCAGCATCACTATTCTCGAGAATAGTGATGCTGCAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081165.1-783s21c1
Sequence:CCGGCATCGAATCAAGAAAGTATTTCTCGAGAAATACTTTCTTGATTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081165.1-85s21c1
Sequence:CCGGGAAGTGAACCGTGCATCAATTCTCGAGAATTGATGCACGGTTCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081165.1-1437s21c1
Sequence:CCGGCCTATCAGTCCTTGATCTAATCTCGAGATTAGATCAAGGACTGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081165.1-463s21c1
Sequence:CCGGTGGACCAATACCCGATGTTTGCTCGAGCAAACATCGGGTATTGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081165.1-1266s21c1
Sequence:CCGGTACTGGTGCAAGCATCAATAACTCGAGTTATTGATGCTTGCACCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081165.1-136s21c1
Sequence:CCGGAGCAACTGTTCTCCTCTTATACTCGAGTATAAGAGGAGAACAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081165
FAM26D MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 26, member D
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081165.1-688s21c1
Sequence:CCGGCCTCTCTGCAGCATCACTATTCTCGAGAATAGTGATGCTGCAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081165.1-783s21c1
Sequence:CCGGCATCGAATCAAGAAAGTATTTCTCGAGAAATACTTTCTTGATTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081165.1-85s21c1
Sequence:CCGGGAAGTGAACCGTGCATCAATTCTCGAGAATTGATGCACGGTTCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081165.1-1437s21c1
Sequence:CCGGCCTATCAGTCCTTGATCTAATCTCGAGATTAGATCAAGGACTGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081165.1-463s21c1
Sequence:CCGGTGGACCAATACCCGATGTTTGCTCGAGCAAACATCGGGTATTGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081165.1-1266s21c1
Sequence:CCGGTACTGGTGCAAGCATCAATAACTCGAGTTATTGATGCTTGCACCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081165.1-136s21c1
Sequence:CCGGAGCAACTGTTCTCCTCTTATACTCGAGTATAAGAGGAGAACAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081165
FAM26D MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 26, member D
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081165.1-688s21c1
Sequence:CCGGCCTCTCTGCAGCATCACTATTCTCGAGAATAGTGATGCTGCAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081165.1-783s21c1
Sequence:CCGGCATCGAATCAAGAAAGTATTTCTCGAGAAATACTTTCTTGATTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081165.1-85s21c1
Sequence:CCGGGAAGTGAACCGTGCATCAATTCTCGAGAATTGATGCACGGTTCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081165.1-1437s21c1
Sequence:CCGGCCTATCAGTCCTTGATCTAATCTCGAGATTAGATCAAGGACTGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081165.1-463s21c1
Sequence:CCGGTGGACCAATACCCGATGTTTGCTCGAGCAAACATCGGGTATTGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081165.1-1266s21c1
Sequence:CCGGTACTGGTGCAAGCATCAATAACTCGAGTTATTGATGCTTGCACCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081165.1-136s21c1
Sequence:CCGGAGCAACTGTTCTCCTCTTATACTCGAGTATAAGAGGAGAACAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)