EMAIL THIS PAGE TO A FRIEND

FAM26E

family with sequence similarity 26, member E

52 Gene Product Result for
Synonyms: C6orf188 dJ493F7.3
UniProtKB ID: Q8N5C1, B2RDJ9, B3KSR3
Gene ID:
Mouse(103511) family with sequence similarity 26, member E
Rat(294431) family with sequence similarity 26, member E
naked mole-rat(101704910) family with sequence similarity 26, member E
domestic guinea pig(100724278) family with sequence similarity 26, member E
Zebrafish(100037308) family with sequence similarity 26, member E
chicken(769904) family with sequence similarity 26, member E
dog(100688567) family with sequence similarity 26, member E
cow(101903708) family with sequence similarity 26, member E
cow(616158) family with sequence similarity 26, member E
domestic cat(101089694) family with sequence similarity 26, member E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153711 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178908 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178908 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178908 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153711 Rosetta Predictions human pricing
NM_001024977 Rosetta Predictions rat pricing
NM_178908 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052577 predicted 509
2 SASI_Hs01_00052578 predicted 457
3 SASI_Hs01_00052579 predicted 604
4 SASI_Hs01_00052581 predicted 1025
5 SASI_Hs01_00052582 predicted 528
6 SASI_Hs02_00367438 predicted 728
7 SASI_Hs01_00052583 predicted 505
8 SASI_Hs01_00052584 predicted 659
9 SASI_Hs01_00052585 predicted 1039
10 SASI_Hs02_00367439 predicted 601
11 SASI_Hs01_00052580 predicted 1024
12 SASI_Hs01_00052586 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102273 predicted 299
2 SASI_Rn01_00102274 predicted 713
3 SASI_Rn01_00102275 predicted 951
4 SASI_Rn01_00102276 predicted 567
5 SASI_Rn01_00102277 predicted 505
6 SASI_Rn01_00102278 predicted 728
7 SASI_Rn01_00102279 predicted 541
8 SASI_Rn02_00202850 predicted 759
9 SASI_Rn01_00102282 predicted 484
10 SASI_Rn02_00202851 predicted 648
11 SASI_Rn01_00102280 predicted 1072
12 SASI_Rn01_00102281 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177082 predicted 992
2 SASI_Mm01_00177083 predicted 1187
3 SASI_Mm01_00177084 predicted 683
4 SASI_Mm01_00177085 predicted 1041
5 SASI_Mm02_00349508 predicted 1256
6 SASI_Mm01_00177086 predicted 541
7 SASI_Mm01_00177087 predicted 767
8 SASI_Mm02_00349509 predicted 776
9 SASI_Mm01_00177089 predicted 573
10 SASI_Mm01_00177090 predicted 623
11 SASI_Mm01_00177081 predicted 1251
12 SASI_Mm01_00177088 predicted 709
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153711
FAM26E MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 26, member E
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153711.1-535s1c1
Sequence:CCGGCACAAAGTATCTTGTGGCAAACTCGAGTTTGCCACAAGATACTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153711.1-1076s1c1
Sequence:CCGGGCAACCTGTGTGTCTCTGTATCTCGAGATACAGAGACACACAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153711.1-874s1c1
Sequence:CCGGGAGCTGCATTCTTTCCACCAACTCGAGTTGGTGGAAAGAATGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153711.1-788s1c1
Sequence:CCGGGCGAGAGGAACCTGAAATGTTCTCGAGAACATTTCAGGTTCCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153711.1-629s1c1
Sequence:CCGGGCCTGATTTGTTCAGCGTCTTCTCGAGAAGACGCTGAACAAATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153711.1-680s1c1
Sequence:CCGGGCTGCCGATCTAAAGTTAGCTCTCGAGAGCTAACTTTAGATCGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153711.1-204s1c1
Sequence:CCGGCAGCACTGAGAATATGACCTACTCGAGTAGGTCATATTCTCAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153711.1-1044s1c1
Sequence:CCGGGCTCATTCTGTGATCCTCCTACTCGAGTAGGAGGATCACAGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153711.1-1240s1c1
Sequence:CCGGGCCTAAATGTTGCTCCAAGATCTCGAGATCTTGGAGCAACATTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153711
FAM26E MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 26, member E
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153711.1-535s1c1
Sequence:CCGGCACAAAGTATCTTGTGGCAAACTCGAGTTTGCCACAAGATACTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153711.1-1076s1c1
Sequence:CCGGGCAACCTGTGTGTCTCTGTATCTCGAGATACAGAGACACACAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153711.1-874s1c1
Sequence:CCGGGAGCTGCATTCTTTCCACCAACTCGAGTTGGTGGAAAGAATGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153711.1-788s1c1
Sequence:CCGGGCGAGAGGAACCTGAAATGTTCTCGAGAACATTTCAGGTTCCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153711.1-629s1c1
Sequence:CCGGGCCTGATTTGTTCAGCGTCTTCTCGAGAAGACGCTGAACAAATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153711.1-680s1c1
Sequence:CCGGGCTGCCGATCTAAAGTTAGCTCTCGAGAGCTAACTTTAGATCGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153711.1-204s1c1
Sequence:CCGGCAGCACTGAGAATATGACCTACTCGAGTAGGTCATATTCTCAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153711.1-1044s1c1
Sequence:CCGGGCTCATTCTGTGATCCTCCTACTCGAGTAGGAGGATCACAGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153711.1-1240s1c1
Sequence:CCGGGCCTAAATGTTGCTCCAAGATCTCGAGATCTTGGAGCAACATTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153711
FAM26E MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 26, member E
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153711.1-535s1c1
Sequence:CCGGCACAAAGTATCTTGTGGCAAACTCGAGTTTGCCACAAGATACTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153711.1-1076s1c1
Sequence:CCGGGCAACCTGTGTGTCTCTGTATCTCGAGATACAGAGACACACAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153711.1-874s1c1
Sequence:CCGGGAGCTGCATTCTTTCCACCAACTCGAGTTGGTGGAAAGAATGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153711.1-788s1c1
Sequence:CCGGGCGAGAGGAACCTGAAATGTTCTCGAGAACATTTCAGGTTCCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153711.1-629s1c1
Sequence:CCGGGCCTGATTTGTTCAGCGTCTTCTCGAGAAGACGCTGAACAAATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153711.1-680s1c1
Sequence:CCGGGCTGCCGATCTAAAGTTAGCTCTCGAGAGCTAACTTTAGATCGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153711.1-204s1c1
Sequence:CCGGCAGCACTGAGAATATGACCTACTCGAGTAGGTCATATTCTCAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153711.1-1044s1c1
Sequence:CCGGGCTCATTCTGTGATCCTCCTACTCGAGTAGGAGGATCACAGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153711.1-1240s1c1
Sequence:CCGGGCCTAAATGTTGCTCCAAGATCTCGAGATCTTGGAGCAACATTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178908
VALIDATED
FAM26E MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 26, member E
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178908.2-772s1c1
Sequence:CCGGCCTGGAATGTGCTAACAAGTTCTCGAGAACTTGTTAGCACATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178908.2-1044s1c1
Sequence:CCGGGTGGTACACTCATTCGGAGTTCTCGAGAACTCCGAATGAGTGTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178908.2-316s1c1
Sequence:CCGGTGGCTGCTGTATGAACCCAAACTCGAGTTTGGGTTCATACAGCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178908.2-1006s1c1
Sequence:CCGGGTTTGTGAATCATCTACCATTCTCGAGAATGGTAGATGATTCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178908.2-1184s1c1
Sequence:CCGGGCTCAGACTGATTGATGCTAACTCGAGTTAGCATCAATCAGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178908.3-794s21c1
Sequence:CCGGAGTGAGAGGAACCTCAAATGCCTCGAGGCATTTGAGGTTCCTCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178908
VALIDATED
FAM26E MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 26, member E
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178908.2-772s1c1
Sequence:CCGGCCTGGAATGTGCTAACAAGTTCTCGAGAACTTGTTAGCACATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178908.2-1044s1c1
Sequence:CCGGGTGGTACACTCATTCGGAGTTCTCGAGAACTCCGAATGAGTGTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178908.2-316s1c1
Sequence:CCGGTGGCTGCTGTATGAACCCAAACTCGAGTTTGGGTTCATACAGCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178908.2-1006s1c1
Sequence:CCGGGTTTGTGAATCATCTACCATTCTCGAGAATGGTAGATGATTCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178908.2-1184s1c1
Sequence:CCGGGCTCAGACTGATTGATGCTAACTCGAGTTAGCATCAATCAGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178908.3-794s21c1
Sequence:CCGGAGTGAGAGGAACCTCAAATGCCTCGAGGCATTTGAGGTTCCTCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178908
VALIDATED
FAM26E MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 26, member E
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178908.2-772s1c1
Sequence:CCGGCCTGGAATGTGCTAACAAGTTCTCGAGAACTTGTTAGCACATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178908.2-1044s1c1
Sequence:CCGGGTGGTACACTCATTCGGAGTTCTCGAGAACTCCGAATGAGTGTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178908.2-316s1c1
Sequence:CCGGTGGCTGCTGTATGAACCCAAACTCGAGTTTGGGTTCATACAGCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178908.2-1006s1c1
Sequence:CCGGGTTTGTGAATCATCTACCATTCTCGAGAATGGTAGATGATTCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178908.2-1184s1c1
Sequence:CCGGGCTCAGACTGATTGATGCTAACTCGAGTTAGCATCAATCAGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178908.3-794s21c1
Sequence:CCGGAGTGAGAGGAACCTCAAATGCCTCGAGGCATTTGAGGTTCCTCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks