EMAIL THIS PAGE TO A FRIEND

FAM26F

family with sequence similarity 26, member F

46 Gene Product Result for
Synonyms: C6orf187 dJ93H18.5
UniProtKB ID: Q5R3K3
Gene ID:
Mouse(215900) family with sequence similarity 26, member F
Rat(294430) family with sequence similarity 26, member F
Zebrafish(780840) family with sequence similarity 26, member F
cow(616136) family with sequence similarity 26, member F
chicken(421744) family with sequence similarity 26, member F
domestic cat(101095901) family with sequence similarity 26, member F
dog(612530) family with sequence similarity 26, member F
naked mole-rat(101705650) family with sequence similarity 26, member F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175449 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175449 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175449 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001010919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010919 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU014611 MISSION® esiRNA esiRNA targeting mouse Fam26f (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010919 Rosetta Predictions human pricing
NM_001024976 Rosetta Predictions rat pricing
NM_175449 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164944 predicted 240
2 SASI_Hs01_00164946 predicted 625
3 SASI_Hs01_00164947 predicted 635
4 SASI_Hs01_00164948 predicted 377
5 SASI_Hs01_00164949 predicted 677
6 SASI_Hs01_00164950 predicted 376
7 SASI_Hs01_00164951 predicted 315
8 SASI_Hs01_00164952 predicted 684
9 SASI_Hs01_00164953 predicted 366
10 SASI_Hs02_00305908 predicted 600
11 SASI_Hs01_00164945 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047310 predicted 629
2 SASI_Rn01_00047312 predicted 536
3 SASI_Rn01_00047313 predicted 818
4 SASI_Rn01_00047314 predicted 644
5 SASI_Rn01_00047315 predicted 733
6 SASI_Rn01_00047317 predicted 434
7 SASI_Rn02_00202848 predicted 743
8 SASI_Rn01_00047318 predicted 768
9 SASI_Rn01_00047319 predicted 293
10 SASI_Rn02_00202849 predicted 581
11 SASI_Rn01_00047311 predicted 598
12 SASI_Rn01_00047316 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075813 predicted 605
2 SASI_Mm01_00075814 predicted 649
3 SASI_Mm01_00075815 predicted 639
4 SASI_Mm01_00075816 predicted 651
5 SASI_Mm01_00075817 predicted 652
6 SASI_Mm01_00075818 predicted 603
7 SASI_Mm01_00075819 predicted 799
8 SASI_Mm02_00346352 predicted 570
9 SASI_Mm01_00075820 predicted 704
10 SASI_Mm01_00075821 predicted 523
11 SASI_Mm01_00075822 predicted 572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175449
FAM26F MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 26, member F
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175449.3-839s21c1
Sequence:CCGGCAGCGTTGTACACATTCAATCCTCGAGGATTGAATGTGTACAACGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175449.3-595s21c1
Sequence:CCGGATTCTGATAGCTGCCGTTATTCTCGAGAATAACGGCAGCTATCAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175449.3-875s21c1
Sequence:CCGGACAGCATGCTGCACAAGTATGCTCGAGCATACTTGTGCAGCATGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175449.3-594s1c1
Sequence:CCGGGATTCTGATAGCTGCCGTTATCTCGAGATAACGGCAGCTATCAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175449.3-802s21c1
Sequence:CCGGTGCAACACTCCAAGCAGTAAACTCGAGTTTACTGCTTGGAGTGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175449.3-649s21c1
Sequence:CCGGTGCTTCTCTCCGGTTAGTTATCTCGAGATAACTAACCGGAGAGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175449.3-828s1c1
Sequence:CCGGGCAGGAAATCTCAGCGTTGTACTCGAGTACAACGCTGAGATTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175449.3-843s1c1
Sequence:CCGGGTTGTACACATTCAATCCCAACTCGAGTTGGGATTGAATGTGTACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175449.3-755s1c1
Sequence:CCGGCCGAAGAGAATGTTAGATGTTCTCGAGAACATCTAACATTCTCTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175449
FAM26F MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 26, member F
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175449.3-839s21c1
Sequence:CCGGCAGCGTTGTACACATTCAATCCTCGAGGATTGAATGTGTACAACGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175449.3-595s21c1
Sequence:CCGGATTCTGATAGCTGCCGTTATTCTCGAGAATAACGGCAGCTATCAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175449.3-875s21c1
Sequence:CCGGACAGCATGCTGCACAAGTATGCTCGAGCATACTTGTGCAGCATGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175449.3-594s1c1
Sequence:CCGGGATTCTGATAGCTGCCGTTATCTCGAGATAACGGCAGCTATCAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175449.3-802s21c1
Sequence:CCGGTGCAACACTCCAAGCAGTAAACTCGAGTTTACTGCTTGGAGTGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175449.3-649s21c1
Sequence:CCGGTGCTTCTCTCCGGTTAGTTATCTCGAGATAACTAACCGGAGAGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175449.3-828s1c1
Sequence:CCGGGCAGGAAATCTCAGCGTTGTACTCGAGTACAACGCTGAGATTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175449.3-843s1c1
Sequence:CCGGGTTGTACACATTCAATCCCAACTCGAGTTGGGATTGAATGTGTACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175449.3-755s1c1
Sequence:CCGGCCGAAGAGAATGTTAGATGTTCTCGAGAACATCTAACATTCTCTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175449
FAM26F MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 26, member F
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175449.3-839s21c1
Sequence:CCGGCAGCGTTGTACACATTCAATCCTCGAGGATTGAATGTGTACAACGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175449.3-595s21c1
Sequence:CCGGATTCTGATAGCTGCCGTTATTCTCGAGAATAACGGCAGCTATCAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175449.3-875s21c1
Sequence:CCGGACAGCATGCTGCACAAGTATGCTCGAGCATACTTGTGCAGCATGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175449.3-594s1c1
Sequence:CCGGGATTCTGATAGCTGCCGTTATCTCGAGATAACGGCAGCTATCAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175449.3-802s21c1
Sequence:CCGGTGCAACACTCCAAGCAGTAAACTCGAGTTTACTGCTTGGAGTGTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175449.3-649s21c1
Sequence:CCGGTGCTTCTCTCCGGTTAGTTATCTCGAGATAACTAACCGGAGAGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175449.3-828s1c1
Sequence:CCGGGCAGGAAATCTCAGCGTTGTACTCGAGTACAACGCTGAGATTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175449.3-843s1c1
Sequence:CCGGGTTGTACACATTCAATCCCAACTCGAGTTGGGATTGAATGTGTACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175449.3-755s1c1
Sequence:CCGGCCGAAGAGAATGTTAGATGTTCTCGAGAACATCTAACATTCTCTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010919
FAM26F MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 26, member F
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-741s1c1
Sequence:CCGGCAGGAGCAGCAGATCCTTAAACTCGAGTTTAAGGATCTGCTGCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-917s1c1
Sequence:CCGGCATGTTGCACAAATATGTCAACTCGAGTTGACATATTTGTGCAACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-708s1c1
Sequence:CCGGCTGCAGCTGAAATTCTGGAAACTCGAGTTTCCAGAATTTCAGCTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-638s1c1
Sequence:CCGGGATAGCAGTTGTTATCATCATCTCGAGATGATGATAACAACTGCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-867s1c1
Sequence:CCGGCAGCAAATTTCATCACTGTATCTCGAGATACAGTGATGAAATTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-629s1c1
Sequence:CCGGCTGGATCTTGATAGCAGTTGTCTCGAGACAACTGCTATCAAGATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010919
FAM26F MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 26, member F
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-741s1c1
Sequence:CCGGCAGGAGCAGCAGATCCTTAAACTCGAGTTTAAGGATCTGCTGCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-917s1c1
Sequence:CCGGCATGTTGCACAAATATGTCAACTCGAGTTGACATATTTGTGCAACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-708s1c1
Sequence:CCGGCTGCAGCTGAAATTCTGGAAACTCGAGTTTCCAGAATTTCAGCTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-638s1c1
Sequence:CCGGGATAGCAGTTGTTATCATCATCTCGAGATGATGATAACAACTGCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-867s1c1
Sequence:CCGGCAGCAAATTTCATCACTGTATCTCGAGATACAGTGATGAAATTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-629s1c1
Sequence:CCGGCTGGATCTTGATAGCAGTTGTCTCGAGACAACTGCTATCAAGATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010919
FAM26F MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 26, member F
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-741s1c1
Sequence:CCGGCAGGAGCAGCAGATCCTTAAACTCGAGTTTAAGGATCTGCTGCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-917s1c1
Sequence:CCGGCATGTTGCACAAATATGTCAACTCGAGTTGACATATTTGTGCAACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-708s1c1
Sequence:CCGGCTGCAGCTGAAATTCTGGAAACTCGAGTTTCCAGAATTTCAGCTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-638s1c1
Sequence:CCGGGATAGCAGTTGTTATCATCATCTCGAGATGATGATAACAACTGCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-867s1c1
Sequence:CCGGCAGCAAATTTCATCACTGTATCTCGAGATACAGTGATGAAATTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010919.1-629s1c1
Sequence:CCGGCTGGATCTTGATAGCAGTTGTCTCGAGACAACTGCTATCAAGATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)