EMAIL THIS PAGE TO A FRIEND

FAM27L

family with sequence similarity 27-like

Species: Human FAM27L(284123)
UniProtKB ID: Q8N5T8
Gene ID:
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203392 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203392 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203392 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203392 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373323 predicted 384
2 SASI_Hs01_00212144 predicted 277
3 SASI_Hs01_00212146 predicted 387
4 SASI_Hs01_00212149 predicted 282
5 SASI_Hs02_00373324 predicted 381
6 SASI_Hs01_00212141 predicted 242
7 SASI_Hs01_00212145 predicted 391
8 SASI_Hs01_00212147 predicted 331
9 SASI_Hs01_00212142 predicted 403
10 SASI_Hs01_00212143 predicted 528
11 SASI_Hs01_00212148 predicted 547
12 SASI_Hs01_00212150 predicted 333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203392
FAM27L MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 27-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203392.1-283s1c1
Sequence:CCGGCGTCCAAGAAGATGGCTGTATCTCGAGATACAGCCATCTTCTTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203392.1-316s1c1
Sequence:CCGGCTTCTCTGAGAAGTGAAGCCACTCGAGTGGCTTCACTTCTCAGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203392.1-286s1c1
Sequence:CCGGCCAAGAAGATGGCTGTATGTTCTCGAGAACATACAGCCATCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203392.1-505s1c1
Sequence:CCGGCTTACTCTGTCTCCCTTGTTTCTCGAGAAACAAGGGAGACAGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203392.1-287s1c1
Sequence:CCGGCAAGAAGATGGCTGTATGTTTCTCGAGAAACATACAGCCATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203392
FAM27L MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 27-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203392.1-283s1c1
Sequence:CCGGCGTCCAAGAAGATGGCTGTATCTCGAGATACAGCCATCTTCTTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203392.1-316s1c1
Sequence:CCGGCTTCTCTGAGAAGTGAAGCCACTCGAGTGGCTTCACTTCTCAGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203392.1-286s1c1
Sequence:CCGGCCAAGAAGATGGCTGTATGTTCTCGAGAACATACAGCCATCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203392.1-505s1c1
Sequence:CCGGCTTACTCTGTCTCCCTTGTTTCTCGAGAAACAAGGGAGACAGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203392.1-287s1c1
Sequence:CCGGCAAGAAGATGGCTGTATGTTTCTCGAGAAACATACAGCCATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203392
FAM27L MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 27-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203392.1-283s1c1
Sequence:CCGGCGTCCAAGAAGATGGCTGTATCTCGAGATACAGCCATCTTCTTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203392.1-316s1c1
Sequence:CCGGCTTCTCTGAGAAGTGAAGCCACTCGAGTGGCTTCACTTCTCAGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203392.1-286s1c1
Sequence:CCGGCCAAGAAGATGGCTGTATGTTCTCGAGAACATACAGCCATCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203392.1-505s1c1
Sequence:CCGGCTTACTCTGTCTCCCTTGTTTCTCGAGAAACAAGGGAGACAGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203392.1-287s1c1
Sequence:CCGGCAAGAAGATGGCTGTATGTTTCTCGAGAAACATACAGCCATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks