EMAIL THIS PAGE TO A FRIEND

FAM32A

family with sequence similarity 32, member A

50 Gene Product Result for
Synonyms: OTAG-12 OTAG12
UniProtKB ID: Q9Y421, Q9BT02
Gene ID:
Mouse(67922) family with sequence similarity 32, member A
Rat(498600) family with sequence similarity 32, member A
domestic guinea pig(100729149) family with sequence similarity 32, member A
naked mole-rat(101707119) family with sequence similarity 32, member A
sheep(101116725) family with sequence similarity 32, member A
chicken(420150) family with sequence similarity 32, member A
cow(508634) family with sequence similarity 32, member A
domestic cat(101093168) family with sequence similarity 32, member A
dog(480644) family with sequence similarity 32, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014077 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014077 Rosetta Predictions human pricing
NM_001128078 Rosetta Predictions rat pricing
NM_026455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111288 predicted 595
2 SASI_Hs01_00111289 predicted 231
3 SASI_Hs01_00111290 predicted 375
4 SASI_Hs01_00111291 predicted 551
5 SASI_Hs01_00111293 predicted 245
6 SASI_Hs01_00111294 predicted 523
7 SASI_Hs01_00111295 predicted 333
8 SASI_Hs01_00111296 predicted 500
9 SASI_Hs01_00111297 predicted 374
10 SASI_Hs02_00345105 predicted 300
11 SASI_Hs01_00111292 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254930 predicted 799
2 SASI_Rn02_00254931 predicted 686
3 SASI_Rn02_00254932 predicted 593
4 SASI_Rn02_00254933 predicted 696
5 SASI_Rn02_00254934 predicted 786
6 SASI_Rn02_00254935 predicted 840
7 SASI_Rn02_00254936 predicted 512
8 SASI_Rn02_00254937 predicted 239
9 SASI_Rn02_00254938 predicted 823
10 SASI_Rn02_00254939 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155123 predicted 721
2 SASI_Mm02_00330304 predicted 661
3 SASI_Mm01_00155128 predicted 582
4 SASI_Mm01_00155125 predicted 872
5 SASI_Mm01_00155124 predicted 579
6 SASI_Mm01_00155127 predicted 568
7 SASI_Mm02_00330305 predicted 591
8 SASI_Mm02_00330306 predicted 269
9 SASI_Mm02_00330307 predicted 804
10 SASI_Mm02_00330308 predicted 555
11 SASI_Mm01_00155126 predicted 601
12 SASI_Mm01_00155129 predicted 720
13 SASI_Mm01_00155130 predicted 594
14 SASI_Mm01_00155131 predicted 684
15 SASI_Mm01_00155132 predicted 613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014077
VALIDATED
FAM32A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 32, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014077.1-1299s1c1
Sequence:CCGGGCTGAGGATCAAACCACATATCTCGAGATATGTGGTTTGATCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014077.1-236s1c1
Sequence:CCGGGCAAATGGAAAGGATCCTAAACTCGAGTTTAGGATCCTTTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014077.1-315s1c1
Sequence:CCGGCTCACGGAGCATTACGACATTCTCGAGAATGTCGTAATGCTCCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014077.1-107s1c1
Sequence:CCGGGAAGGACAAAGACAAAGCGAACTCGAGTTCGCTTTGTCTTTGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014077.1-321s1c1
Sequence:CCGGGAGCATTACGACATTCCCAAACTCGAGTTTGGGAATGTCGTAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014077
VALIDATED
FAM32A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 32, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014077.1-1299s1c1
Sequence:CCGGGCTGAGGATCAAACCACATATCTCGAGATATGTGGTTTGATCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014077.1-236s1c1
Sequence:CCGGGCAAATGGAAAGGATCCTAAACTCGAGTTTAGGATCCTTTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014077.1-315s1c1
Sequence:CCGGCTCACGGAGCATTACGACATTCTCGAGAATGTCGTAATGCTCCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014077.1-107s1c1
Sequence:CCGGGAAGGACAAAGACAAAGCGAACTCGAGTTCGCTTTGTCTTTGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014077.1-321s1c1
Sequence:CCGGGAGCATTACGACATTCCCAAACTCGAGTTTGGGAATGTCGTAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014077
VALIDATED
FAM32A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 32, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014077.1-1299s1c1
Sequence:CCGGGCTGAGGATCAAACCACATATCTCGAGATATGTGGTTTGATCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014077.1-236s1c1
Sequence:CCGGGCAAATGGAAAGGATCCTAAACTCGAGTTTAGGATCCTTTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014077.1-315s1c1
Sequence:CCGGCTCACGGAGCATTACGACATTCTCGAGAATGTCGTAATGCTCCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014077.1-107s1c1
Sequence:CCGGGAAGGACAAAGACAAAGCGAACTCGAGTTCGCTTTGTCTTTGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014077.1-321s1c1
Sequence:CCGGGAGCATTACGACATTCCCAAACTCGAGTTTGGGAATGTCGTAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026455
FAM32A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 32, member A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026455.2-1553s1c1
Sequence:CCGGGCATACAATATACACAGTCTTCTCGAGAAGACTGTGTATATTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026455.2-118s1c1
Sequence:CCGGCGGCGTGACAAAGCGGAAGAACTCGAGTTCTTCCGCTTTGTCACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026455.2-353s1c1
Sequence:CCGGCTCACTGAGCACTATGACATTCTCGAGAATGTCATAGTGCTCAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026455.2-274s1c1
Sequence:CCGGGCAAATGGAAAGAATCCTGAACTCGAGTTCAGGATTCTTTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026455.2-330s1c1
Sequence:CCGGACTTCAACCGACACCTGGATACTCGAGTATCCAGGTGTCGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026455.4-1552s21c1
Sequence:CCGGGCATACAATATACACAGTCTTCTCGAGAAGACTGTGTATATTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026455.4-329s21c1
Sequence:CCGGACTTCAACCGACACCTGGATACTCGAGTATCCAGGTGTCGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026455.4-273s21c1
Sequence:CCGGGCAAATGGAAAGAATCCTGAACTCGAGTTCAGGATTCTTTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026455.4-352s21c1
Sequence:CCGGCTCACTGAGCACTATGACATTCTCGAGAATGTCATAGTGCTCAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026455.4-117s21c1
Sequence:CCGGCGGCGTGACAAAGCGGAAGAACTCGAGTTCTTCCGCTTTGTCACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026455
FAM32A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 32, member A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026455.2-1553s1c1
Sequence:CCGGGCATACAATATACACAGTCTTCTCGAGAAGACTGTGTATATTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026455.2-118s1c1
Sequence:CCGGCGGCGTGACAAAGCGGAAGAACTCGAGTTCTTCCGCTTTGTCACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026455.2-353s1c1
Sequence:CCGGCTCACTGAGCACTATGACATTCTCGAGAATGTCATAGTGCTCAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026455.2-274s1c1
Sequence:CCGGGCAAATGGAAAGAATCCTGAACTCGAGTTCAGGATTCTTTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026455.2-330s1c1
Sequence:CCGGACTTCAACCGACACCTGGATACTCGAGTATCCAGGTGTCGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026455.4-1552s21c1
Sequence:CCGGGCATACAATATACACAGTCTTCTCGAGAAGACTGTGTATATTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026455.4-329s21c1
Sequence:CCGGACTTCAACCGACACCTGGATACTCGAGTATCCAGGTGTCGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026455.4-273s21c1
Sequence:CCGGGCAAATGGAAAGAATCCTGAACTCGAGTTCAGGATTCTTTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026455.4-352s21c1
Sequence:CCGGCTCACTGAGCACTATGACATTCTCGAGAATGTCATAGTGCTCAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026455.4-117s21c1
Sequence:CCGGCGGCGTGACAAAGCGGAAGAACTCGAGTTCTTCCGCTTTGTCACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026455
FAM32A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 32, member A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026455.2-1553s1c1
Sequence:CCGGGCATACAATATACACAGTCTTCTCGAGAAGACTGTGTATATTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026455.2-118s1c1
Sequence:CCGGCGGCGTGACAAAGCGGAAGAACTCGAGTTCTTCCGCTTTGTCACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026455.2-353s1c1
Sequence:CCGGCTCACTGAGCACTATGACATTCTCGAGAATGTCATAGTGCTCAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026455.2-274s1c1
Sequence:CCGGGCAAATGGAAAGAATCCTGAACTCGAGTTCAGGATTCTTTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026455.2-330s1c1
Sequence:CCGGACTTCAACCGACACCTGGATACTCGAGTATCCAGGTGTCGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026455.4-1552s21c1
Sequence:CCGGGCATACAATATACACAGTCTTCTCGAGAAGACTGTGTATATTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026455.4-329s21c1
Sequence:CCGGACTTCAACCGACACCTGGATACTCGAGTATCCAGGTGTCGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026455.4-273s21c1
Sequence:CCGGGCAAATGGAAAGAATCCTGAACTCGAGTTCAGGATTCTTTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026455.4-352s21c1
Sequence:CCGGCTCACTGAGCACTATGACATTCTCGAGAATGTCATAGTGCTCAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026455.4-117s21c1
Sequence:CCGGCGGCGTGACAAAGCGGAAGAACTCGAGTTCTTCCGCTTTGTCACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks