EMAIL THIS PAGE TO A FRIEND

FAM35A

family with sequence similarity 35, member A

60 Gene Product Result for
Synonyms: FAM35A1 bA163M19.1
UniProtKB ID: Q86V20, O95885, Q9H991
Gene ID:
Mouse(75698) family with sequence similarity 35, member A
Rat(364514) family with sequence similarity 35, member A
domestic guinea pig(100722242) family with sequence similarity 35, member A
naked mole-rat(101697602) family with sequence similarity 35, member A
sheep(101113562) family with sequence similarity 35, member A
Zebrafish(100149820) family with sequence similarity 35, member A
cow(508335) family with sequence similarity 35, member A
domestic cat(101090295) family with sequence similarity 35, member A
chicken(423613) family with sequence similarity 35, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019054 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029389 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029389 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029389 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019054 Rosetta Predictions human pricing
NM_001025028 Rosetta Predictions rat pricing
NM_029389 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352632 predicted 2187
2 SASI_Hs01_00210119 predicted 1511
3 SASI_Hs01_00210120 predicted 1776
4 SASI_Hs01_00210121 predicted 235
5 SASI_Hs01_00210123 predicted 1736
6 SASI_Hs01_00210124 predicted 557
7 SASI_Hs02_00352633 predicted 2534
8 SASI_Hs02_00352634 predicted 2490
9 SASI_Hs01_00210126 predicted 2118
10 SASI_Hs01_00210127 predicted 1907
11 SASI_Hs01_00210122 predicted 2140
12 SASI_Hs01_00210125 predicted 355
13 SASI_Hs01_00210128 predicted 2137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116303 predicted 1454
2 SASI_Rn02_00202941 predicted 1563
3 SASI_Rn01_00116304 predicted 641
4 SASI_Rn01_00116305 predicted 1269
5 SASI_Rn01_00116306 predicted 1880
6 SASI_Rn01_00116307 predicted 1876
7 SASI_Rn01_00116308 predicted 587
8 SASI_Rn01_00116309 predicted 1719
9 SASI_Rn01_00116310 predicted 396
10 SASI_Rn01_00116311 predicted 1878
11 SASI_Rn01_00116312 predicted 1852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128019 predicted 777
2 SASI_Mm02_00335276 predicted 2785
3 SASI_Mm02_00335277 predicted 2560
4 SASI_Mm01_00128020 predicted 959
5 SASI_Mm01_00128023 predicted 1148
6 SASI_Mm02_00335278 predicted 1794
7 SASI_Mm02_00335279 predicted 1791
8 SASI_Mm01_00128026 predicted 2275
9 SASI_Mm01_00128027 predicted 588
10 SASI_Mm02_00335280 predicted 2198
11 SASI_Mm01_00128021 predicted 1813
12 SASI_Mm01_00128022 predicted 2902
13 SASI_Mm01_00128024 predicted 2326
14 SASI_Mm01_00128025 predicted 1827
15 SASI_Mm01_00128028 predicted 3004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019054
VALIDATED
FAM35A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 35, member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019054.2-1201s21c1
Sequence:CCGGATACTGTGTTCCCAACTAAATCTCGAGATTTAGTTGGGAACACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_019054.2-569s21c1
Sequence:CCGGCTAAACATCAGCCAGATATATCTCGAGATATATCTGGCTGATGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_019054.2-2308s21c1
Sequence:CCGGCCAGCGTTAATGACTGCCATTCTCGAGAATGGCAGTCATTAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_019054.2-425s21c1
Sequence:CCGGCCCAGAAGATTCACTCCTCTACTCGAGTAGAGGAGTGAATCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019054.2-2996s21c1
Sequence:CCGGTTTCGCTTATCCCTACCTAAACTCGAGTTTAGGTAGGGATAAGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_019054.1-2896s1c1
Sequence:CCGGGCCCATTTGTTCACTGTATTTCTCGAGAAATACAGTGAACAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019054.1-1497s1c1
Sequence:CCGGCGGACCAAATTCTGGCTCTAACTCGAGTTAGAGCCAGAATTTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_019054.1-2308s1c1
Sequence:CCGGCCAGCGTTAATGACTGCCATTCTCGAGAATGGCAGTCATTAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019054.1-904s1c1
Sequence:CCGGCCTGTAAATAAAGGGAATGTACTCGAGTACATTCCCTTTATTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019054.1-425s1c1
Sequence:CCGGCCCAGAAGATTCACTCCTCTACTCGAGTAGAGGAGTGAATCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019054
VALIDATED
FAM35A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 35, member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019054.2-1201s21c1
Sequence:CCGGATACTGTGTTCCCAACTAAATCTCGAGATTTAGTTGGGAACACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_019054.2-569s21c1
Sequence:CCGGCTAAACATCAGCCAGATATATCTCGAGATATATCTGGCTGATGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_019054.2-2308s21c1
Sequence:CCGGCCAGCGTTAATGACTGCCATTCTCGAGAATGGCAGTCATTAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_019054.2-425s21c1
Sequence:CCGGCCCAGAAGATTCACTCCTCTACTCGAGTAGAGGAGTGAATCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019054.2-2996s21c1
Sequence:CCGGTTTCGCTTATCCCTACCTAAACTCGAGTTTAGGTAGGGATAAGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_019054.1-2896s1c1
Sequence:CCGGGCCCATTTGTTCACTGTATTTCTCGAGAAATACAGTGAACAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019054.1-1497s1c1
Sequence:CCGGCGGACCAAATTCTGGCTCTAACTCGAGTTAGAGCCAGAATTTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_019054.1-2308s1c1
Sequence:CCGGCCAGCGTTAATGACTGCCATTCTCGAGAATGGCAGTCATTAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019054.1-904s1c1
Sequence:CCGGCCTGTAAATAAAGGGAATGTACTCGAGTACATTCCCTTTATTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019054.1-425s1c1
Sequence:CCGGCCCAGAAGATTCACTCCTCTACTCGAGTAGAGGAGTGAATCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019054
VALIDATED
FAM35A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 35, member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019054.2-1201s21c1
Sequence:CCGGATACTGTGTTCCCAACTAAATCTCGAGATTTAGTTGGGAACACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_019054.2-569s21c1
Sequence:CCGGCTAAACATCAGCCAGATATATCTCGAGATATATCTGGCTGATGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_019054.2-2308s21c1
Sequence:CCGGCCAGCGTTAATGACTGCCATTCTCGAGAATGGCAGTCATTAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_019054.2-425s21c1
Sequence:CCGGCCCAGAAGATTCACTCCTCTACTCGAGTAGAGGAGTGAATCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019054.2-2996s21c1
Sequence:CCGGTTTCGCTTATCCCTACCTAAACTCGAGTTTAGGTAGGGATAAGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_019054.1-2896s1c1
Sequence:CCGGGCCCATTTGTTCACTGTATTTCTCGAGAAATACAGTGAACAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019054.1-1497s1c1
Sequence:CCGGCGGACCAAATTCTGGCTCTAACTCGAGTTAGAGCCAGAATTTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_019054.1-2308s1c1
Sequence:CCGGCCAGCGTTAATGACTGCCATTCTCGAGAATGGCAGTCATTAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019054.1-904s1c1
Sequence:CCGGCCTGTAAATAAAGGGAATGTACTCGAGTACATTCCCTTTATTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019054.1-425s1c1
Sequence:CCGGCCCAGAAGATTCACTCCTCTACTCGAGTAGAGGAGTGAATCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029389
FAM35A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 35, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029389.1-1663s1c1
Sequence:CCGGGCAACGATTGTAGTTATTGATCTCGAGATCAATAACTACAATCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029389.1-807s1c1
Sequence:CCGGCCAAAGAGATTTGTTTGCGTTCTCGAGAACGCAAACAAATCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029389.1-3126s1c1
Sequence:CCGGGATCCCGAGACTAGAGTAATACTCGAGTATTACTCTAGTCTCGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029389.1-2663s1c1
Sequence:CCGGCCATAGTTGATGGAAGATATACTCGAGTATATCTTCCATCAACTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029389.1-644s1c1
Sequence:CCGGCCCAGGTTAACCTGAGTGATACTCGAGTATCACTCAGGTTAACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029389
FAM35A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 35, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029389.1-1663s1c1
Sequence:CCGGGCAACGATTGTAGTTATTGATCTCGAGATCAATAACTACAATCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029389.1-807s1c1
Sequence:CCGGCCAAAGAGATTTGTTTGCGTTCTCGAGAACGCAAACAAATCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029389.1-3126s1c1
Sequence:CCGGGATCCCGAGACTAGAGTAATACTCGAGTATTACTCTAGTCTCGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029389.1-2663s1c1
Sequence:CCGGCCATAGTTGATGGAAGATATACTCGAGTATATCTTCCATCAACTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029389.1-644s1c1
Sequence:CCGGCCCAGGTTAACCTGAGTGATACTCGAGTATCACTCAGGTTAACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029389
FAM35A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 35, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029389.1-1663s1c1
Sequence:CCGGGCAACGATTGTAGTTATTGATCTCGAGATCAATAACTACAATCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029389.1-807s1c1
Sequence:CCGGCCAAAGAGATTTGTTTGCGTTCTCGAGAACGCAAACAAATCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029389.1-3126s1c1
Sequence:CCGGGATCCCGAGACTAGAGTAATACTCGAGTATTACTCTAGTCTCGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029389.1-2663s1c1
Sequence:CCGGCCATAGTTGATGGAAGATATACTCGAGTATATCTTCCATCAACTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029389.1-644s1c1
Sequence:CCGGCCCAGGTTAACCTGAGTGATACTCGAGTATCACTCAGGTTAACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks