EMAIL THIS PAGE TO A FRIEND

FAM3A

family with sequence similarity 3, member A

48 Gene Product Result for
Synonyms: 2.19 DLD DXS560S XAP-7
Gene ID:
Mouse(66294) family with sequence similarity 3, member A
Rat(501664) family with sequence similarity 3, member A
Zebrafish(393773) family with sequence similarity 3, member A
cow(614075) family with sequence similarity 3, member A
domestic cat(101085699) family with sequence similarity 3, member A
dog(612570) family with sequence similarity 3, member A
sheep(101107576) family with sequence similarity 3, member A
naked mole-rat(101711209) family with sequence similarity 3, member A
domestic guinea pig(100723043) family with sequence similarity 3, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025473 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025473 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025473 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021806 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021806 Rosetta Predictions human pricing
NM_001109324 Rosetta Predictions rat pricing
NM_025473 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014293 predicted 297
2 SASI_Hs02_00355107 predicted 933
3 SASI_Hs01_00014295 predicted 1185
4 SASI_Hs01_00014296 predicted 1374
5 SASI_Hs01_00014297 predicted 1235
6 SASI_Hs02_00355108 predicted 1315
7 SASI_Hs01_00014299 predicted 521
8 SASI_Hs01_00014300 predicted 316
9 SASI_Hs01_00014301 predicted 882
10 SASI_Hs01_00014302 predicted 665
11 SASI_Hs01_00014294 predicted 746
12 SASI_Hs01_00014298 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247304 predicted 1052
2 SASI_Rn02_00247305 predicted 855
3 SASI_Rn02_00247306 predicted 766
4 SASI_Rn02_00247307 predicted 1173
5 SASI_Rn02_00247308 predicted 414
6 SASI_Rn02_00247309 predicted 465
7 SASI_Rn02_00247310 predicted 911
8 SASI_Rn02_00247311 predicted 1273
9 SASI_Rn02_00247312 predicted 1282
10 SASI_Rn02_00247313 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159090 predicted 1004
2 SASI_Mm01_00159091 predicted 995
3 SASI_Mm01_00159092 predicted 825
4 SASI_Mm01_00159093 predicted 651
5 SASI_Mm01_00159094 predicted 960
6 SASI_Mm01_00159095 predicted 527
7 SASI_Mm02_00328333 predicted 879
8 SASI_Mm01_00159096 predicted 876
9 SASI_Mm01_00159098 predicted 885
10 SASI_Mm02_00328334 predicted 1057
11 SASI_Mm01_00159097 predicted 720
12 SASI_Mm01_00159099 predicted 638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025473
FAM3A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 3, member A
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025473.1-1047s1c1
Sequence:CCGGGCAGCATATGAAGAACAGTAACTCGAGTTACTGTTCTTCATATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025473.1-486s1c1
Sequence:CCGGCCTAATCATCATTATGGGTCTCTCGAGAGACCCATAATGATGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025473.1-927s1c1
Sequence:CCGGGAATGAAGAGACCAGGAAGCTCTCGAGAGCTTCCTGGTCTCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-766s21c1
Sequence:CCGGTGAACATCGCCCTGGTGAATGCTCGAGCATTCACCAGGGCGATGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-910s21c1
Sequence:CCGGATCCAGCTACCAAGATGAATGCTCGAGCATTCATCTTGGTAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-607s21c1
Sequence:CCGGCAAGGGCCAGGAAGTACAAATCTCGAGATTTGTACTTCCTGGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-478s21c1
Sequence:CCGGTCGTGGCCCTAATCATCATTACTCGAGTAATGATGATTAGGGCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-654s21c1
Sequence:CCGGGAGCACCTGAGCTTTCGAATACTCGAGTATTCGAAAGCTCAGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215925    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025473.3-1565s1c1
Sequence:CCGGCAGTGATCCTTTAAGCCAAATCTCGAGATTTGGCTTAAAGGATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217291    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025473.3-1502s1c1
Sequence:CCGGGTTGGGACATCTTCAAGAAACCTCGAGGTTTCTTGAAGATGTCCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025473.3-1242s21c1
Sequence:CCGGTAACACATTAGGGCTTGAAAGCTCGAGCTTTCAAGCCCTAATGTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-727s21c1
Sequence:CCGGTGCTCATGAGCAGCGTCAAAGCTCGAGCTTTGACGCTGCTCATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025473
FAM3A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 3, member A
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025473.1-1047s1c1
Sequence:CCGGGCAGCATATGAAGAACAGTAACTCGAGTTACTGTTCTTCATATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025473.1-486s1c1
Sequence:CCGGCCTAATCATCATTATGGGTCTCTCGAGAGACCCATAATGATGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025473.1-927s1c1
Sequence:CCGGGAATGAAGAGACCAGGAAGCTCTCGAGAGCTTCCTGGTCTCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-766s21c1
Sequence:CCGGTGAACATCGCCCTGGTGAATGCTCGAGCATTCACCAGGGCGATGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-910s21c1
Sequence:CCGGATCCAGCTACCAAGATGAATGCTCGAGCATTCATCTTGGTAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-607s21c1
Sequence:CCGGCAAGGGCCAGGAAGTACAAATCTCGAGATTTGTACTTCCTGGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-478s21c1
Sequence:CCGGTCGTGGCCCTAATCATCATTACTCGAGTAATGATGATTAGGGCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-654s21c1
Sequence:CCGGGAGCACCTGAGCTTTCGAATACTCGAGTATTCGAAAGCTCAGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215925    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025473.3-1565s1c1
Sequence:CCGGCAGTGATCCTTTAAGCCAAATCTCGAGATTTGGCTTAAAGGATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217291    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025473.3-1502s1c1
Sequence:CCGGGTTGGGACATCTTCAAGAAACCTCGAGGTTTCTTGAAGATGTCCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025473.3-1242s21c1
Sequence:CCGGTAACACATTAGGGCTTGAAAGCTCGAGCTTTCAAGCCCTAATGTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-727s21c1
Sequence:CCGGTGCTCATGAGCAGCGTCAAAGCTCGAGCTTTGACGCTGCTCATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025473
FAM3A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 3, member A
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025473.1-1047s1c1
Sequence:CCGGGCAGCATATGAAGAACAGTAACTCGAGTTACTGTTCTTCATATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025473.1-486s1c1
Sequence:CCGGCCTAATCATCATTATGGGTCTCTCGAGAGACCCATAATGATGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025473.1-927s1c1
Sequence:CCGGGAATGAAGAGACCAGGAAGCTCTCGAGAGCTTCCTGGTCTCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-766s21c1
Sequence:CCGGTGAACATCGCCCTGGTGAATGCTCGAGCATTCACCAGGGCGATGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-910s21c1
Sequence:CCGGATCCAGCTACCAAGATGAATGCTCGAGCATTCATCTTGGTAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-607s21c1
Sequence:CCGGCAAGGGCCAGGAAGTACAAATCTCGAGATTTGTACTTCCTGGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-478s21c1
Sequence:CCGGTCGTGGCCCTAATCATCATTACTCGAGTAATGATGATTAGGGCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-654s21c1
Sequence:CCGGGAGCACCTGAGCTTTCGAATACTCGAGTATTCGAAAGCTCAGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215925    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025473.3-1565s1c1
Sequence:CCGGCAGTGATCCTTTAAGCCAAATCTCGAGATTTGGCTTAAAGGATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217291    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025473.3-1502s1c1
Sequence:CCGGGTTGGGACATCTTCAAGAAACCTCGAGGTTTCTTGAAGATGTCCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025473.3-1242s21c1
Sequence:CCGGTAACACATTAGGGCTTGAAAGCTCGAGCTTTCAAGCCCTAATGTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025473.3-727s21c1
Sequence:CCGGTGCTCATGAGCAGCGTCAAAGCTCGAGCTTTGACGCTGCTCATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021806
VALIDATED
FAM3A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 3, member A
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021806.1-737s1c1
Sequence:CCGGCCAGCCACCAAGATGAATGAACTCGAGTTCATTCATCTTGGTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021806.1-874s1c1
Sequence:CCGGGCACGTGAAGAACAGTAAGCACTCGAGTGCTTACTGTTCTTCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_021806.1-740s1c1
Sequence:CCGGGCCACCAAGATGAATGAAGAGCTCGAGCTCTTCATTCATCTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021806.1-1417s1c1
Sequence:CCGGGATTCCTTCCAGTGAGCCAAACTCGAGTTTGGCTCACTGGAAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021806.1-871s1c1
Sequence:CCGGGCAGCACGTGAAGAACAGTAACTCGAGTTACTGTTCTTCACGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021806.1-1394s1c1
Sequence:CCGGCGGGCTAAACATGTTTCCAGTCTCGAGACTGGAAACATGTTTAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021806.1-886s1c1
Sequence:CCGGCAGTAAGCACAGCAACAAGTACTCGAGTACTTGTTGCTGTGCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021806.1-880s1c1
Sequence:CCGGGAAGAACAGTAAGCACAGCAACTCGAGTTGCTGTGCTTACTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021806.1-883s1c1
Sequence:CCGGGAACAGTAAGCACAGCAACAACTCGAGTTGTTGCTGTGCTTACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021806.1-674s1c1
Sequence:CCGGCTGTTGAAGTTTATTCGGCCACTCGAGTGGCCGAATAAACTTCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021806.1-744s1c1
Sequence:CCGGCCAAGATGAATGAAGAGACCACTCGAGTGGTCTCTTCATTCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021806.1-886s21c1
Sequence:CCGGCAGTAAGCACAGCAACAAGTACTCGAGTACTTGTTGCTGTGCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021806.1-1417s21c1
Sequence:CCGGGATTCCTTCCAGTGAGCCAAACTCGAGTTTGGCTCACTGGAAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021806.1-874s21c1
Sequence:CCGGGCACGTGAAGAACAGTAAGCACTCGAGTGCTTACTGTTCTTCACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021806.1-1394s21c1
Sequence:CCGGCGGGCTAAACATGTTTCCAGTCTCGAGACTGGAAACATGTTTAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021806
VALIDATED
FAM3A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 3, member A
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021806.1-737s1c1
Sequence:CCGGCCAGCCACCAAGATGAATGAACTCGAGTTCATTCATCTTGGTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021806.1-874s1c1
Sequence:CCGGGCACGTGAAGAACAGTAAGCACTCGAGTGCTTACTGTTCTTCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_021806.1-740s1c1
Sequence:CCGGGCCACCAAGATGAATGAAGAGCTCGAGCTCTTCATTCATCTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021806.1-1417s1c1
Sequence:CCGGGATTCCTTCCAGTGAGCCAAACTCGAGTTTGGCTCACTGGAAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021806.1-871s1c1
Sequence:CCGGGCAGCACGTGAAGAACAGTAACTCGAGTTACTGTTCTTCACGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021806.1-1394s1c1
Sequence:CCGGCGGGCTAAACATGTTTCCAGTCTCGAGACTGGAAACATGTTTAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021806.1-886s1c1
Sequence:CCGGCAGTAAGCACAGCAACAAGTACTCGAGTACTTGTTGCTGTGCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021806.1-880s1c1
Sequence:CCGGGAAGAACAGTAAGCACAGCAACTCGAGTTGCTGTGCTTACTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021806.1-883s1c1
Sequence:CCGGGAACAGTAAGCACAGCAACAACTCGAGTTGTTGCTGTGCTTACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021806.1-674s1c1
Sequence:CCGGCTGTTGAAGTTTATTCGGCCACTCGAGTGGCCGAATAAACTTCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021806.1-744s1c1
Sequence:CCGGCCAAGATGAATGAAGAGACCACTCGAGTGGTCTCTTCATTCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021806.1-886s21c1
Sequence:CCGGCAGTAAGCACAGCAACAAGTACTCGAGTACTTGTTGCTGTGCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021806.1-1417s21c1
Sequence:CCGGGATTCCTTCCAGTGAGCCAAACTCGAGTTTGGCTCACTGGAAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021806.1-874s21c1
Sequence:CCGGGCACGTGAAGAACAGTAAGCACTCGAGTGCTTACTGTTCTTCACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021806.1-1394s21c1
Sequence:CCGGCGGGCTAAACATGTTTCCAGTCTCGAGACTGGAAACATGTTTAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021806
VALIDATED
FAM3A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 3, member A
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021806.1-737s1c1
Sequence:CCGGCCAGCCACCAAGATGAATGAACTCGAGTTCATTCATCTTGGTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021806.1-874s1c1
Sequence:CCGGGCACGTGAAGAACAGTAAGCACTCGAGTGCTTACTGTTCTTCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_021806.1-740s1c1
Sequence:CCGGGCCACCAAGATGAATGAAGAGCTCGAGCTCTTCATTCATCTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021806.1-1417s1c1
Sequence:CCGGGATTCCTTCCAGTGAGCCAAACTCGAGTTTGGCTCACTGGAAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021806.1-871s1c1
Sequence:CCGGGCAGCACGTGAAGAACAGTAACTCGAGTTACTGTTCTTCACGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021806.1-1394s1c1
Sequence:CCGGCGGGCTAAACATGTTTCCAGTCTCGAGACTGGAAACATGTTTAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021806.1-886s1c1
Sequence:CCGGCAGTAAGCACAGCAACAAGTACTCGAGTACTTGTTGCTGTGCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021806.1-880s1c1
Sequence:CCGGGAAGAACAGTAAGCACAGCAACTCGAGTTGCTGTGCTTACTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021806.1-883s1c1
Sequence:CCGGGAACAGTAAGCACAGCAACAACTCGAGTTGTTGCTGTGCTTACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021806.1-674s1c1
Sequence:CCGGCTGTTGAAGTTTATTCGGCCACTCGAGTGGCCGAATAAACTTCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021806.1-744s1c1
Sequence:CCGGCCAAGATGAATGAAGAGACCACTCGAGTGGTCTCTTCATTCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021806.1-886s21c1
Sequence:CCGGCAGTAAGCACAGCAACAAGTACTCGAGTACTTGTTGCTGTGCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021806.1-1417s21c1
Sequence:CCGGGATTCCTTCCAGTGAGCCAAACTCGAGTTTGGCTCACTGGAAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021806.1-874s21c1
Sequence:CCGGGCACGTGAAGAACAGTAAGCACTCGAGTGCTTACTGTTCTTCACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021806.1-1394s21c1
Sequence:CCGGCGGGCTAAACATGTTTCCAGTCTCGAGACTGGAAACATGTTTAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks