EMAIL THIS PAGE TO A FRIEND

FAM3B

family with sequence similarity 3, member B

114 Gene Product Result for
Synonyms: 2-21 C21orf11 C21orf76 ORF9 PANDER
UniProtKB ID: P58499
Gene ID:
Mouse(52793) family with sequence similarity 3, member B
Rat(304050) family with sequence similarity 3, member B
naked mole-rat(101717391) family with sequence similarity 3, member B
sheep(101119956) family with sequence similarity 3, member B
chicken(418527) family with sequence similarity 3, member B
dog(478419) family with sequence similarity 3, member B
cow(514701) family with sequence similarity 3, member B
domestic cat(101096506) family with sequence similarity 3, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058186 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020622 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020622 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020622 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058186 Rosetta Predictions human pricing
NM_206964 Rosetta Predictions human pricing
NM_001107102 Rosetta Predictions rat pricing
NM_020622 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171779 predicted 647
2 SASI_Hs01_00171780 predicted 629
3 SASI_Hs01_00171782 predicted 979
4 SASI_Hs01_00171784 predicted 610
5 SASI_Hs01_00171786 predicted 1110
6 SASI_Hs01_00171787 predicted 969
7 SASI_Hs01_00171788 predicted 979
8 SASI_Hs02_00362108 predicted 1048
9 SASI_Hs02_00362109 predicted 530
10 SASI_Hs02_00362110 predicted 938
11 SASI_Hs01_00171781 predicted 867
12 SASI_Hs01_00171783 predicted 1046
13 SASI_Hs01_00171785 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229569 predicted 511
2 SASI_Hs01_00229570 predicted 482
3 SASI_Hs01_00229572 predicted 835
4 SASI_Hs01_00229574 predicted 466
5 SASI_Hs01_00229576 predicted 963
6 SASI_Hs01_00229577 predicted 826
7 SASI_Hs01_00229578 predicted 829
8 SASI_Hs02_00373664 predicted 900
9 SASI_Hs02_00373665 predicted 392
10 SASI_Hs02_00373666 predicted 793
11 SASI_Hs01_00229571 predicted 732
12 SASI_Hs01_00229573 predicted 908
13 SASI_Hs01_00229575 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225516 predicted 504
2 SASI_Rn02_00225517 predicted 480
3 SASI_Rn02_00225518 predicted 529
4 SASI_Rn02_00225519 predicted 521
5 SASI_Rn02_00225520 predicted 196
6 SASI_Rn02_00225521 predicted 671
7 SASI_Rn02_00225522 predicted 398
8 SASI_Rn02_00225523 predicted 603
9 SASI_Rn02_00225524 predicted 719
10 SASI_Rn02_00225525 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198783 predicted 561
2 SASI_Mm01_00198784 predicted 458
3 SASI_Mm01_00198785 predicted 399
4 SASI_Mm01_00198787 predicted 600
5 SASI_Mm01_00198788 predicted 501
6 SASI_Mm01_00198790 predicted 479
7 SASI_Mm02_00325755 predicted 449
8 SASI_Mm02_00325756 predicted 467
9 SASI_Mm01_00198791 predicted 569
10 SASI_Mm01_00198792 predicted 216
11 SASI_Mm01_00198786 predicted 437
12 SASI_Mm01_00198789 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058186
FAM3B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 3, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058186.3-697s21c1
Sequence:CCGGTCAGGTCTAGCTGGGTATTTACTCGAGTAAATACCCAGCTAGACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058186.3-732s21c1
Sequence:CCGGTTGGAACTCCCTTCCGAAATTCTCGAGAATTTCGGAAGGGAGTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058186.3-928s21c1
Sequence:CCGGTAAATCCAACAGCCCATATTTCTCGAGAAATATGGGCTGTTGGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058186.3-770s1c1
Sequence:CCGGCCACTCTGATGCTAAGAACAACTCGAGTTGTTCTTAGCATCAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058186.3-767s1c1
Sequence:CCGGCAACCACTCTGATGCTAAGAACTCGAGTTCTTAGCATCAGAGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058186.3-418s1c1
Sequence:CCGGGCTTTGAGGATAACCTACTTACTCGAGTAAGTAGGTTATCCTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058186.3-999s1c1
Sequence:CCGGCAAATCTTGGTACGCAGTATTCTCGAGAATACTGCGTACCAAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147886    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058186.3-1043s1c1
Sequence:CCGGGAAGATGTCAATTAGCAGGAACTCGAGTTCCTGCTAATTGACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058186.3-486s1c1
Sequence:CCGGGTCAACTATGTAACTGGGAATCTCGAGATTCCCAGTTACATAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058186
FAM3B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 3, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058186.3-697s21c1
Sequence:CCGGTCAGGTCTAGCTGGGTATTTACTCGAGTAAATACCCAGCTAGACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058186.3-732s21c1
Sequence:CCGGTTGGAACTCCCTTCCGAAATTCTCGAGAATTTCGGAAGGGAGTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058186.3-928s21c1
Sequence:CCGGTAAATCCAACAGCCCATATTTCTCGAGAAATATGGGCTGTTGGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058186.3-770s1c1
Sequence:CCGGCCACTCTGATGCTAAGAACAACTCGAGTTGTTCTTAGCATCAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058186.3-767s1c1
Sequence:CCGGCAACCACTCTGATGCTAAGAACTCGAGTTCTTAGCATCAGAGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058186.3-418s1c1
Sequence:CCGGGCTTTGAGGATAACCTACTTACTCGAGTAAGTAGGTTATCCTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058186.3-999s1c1
Sequence:CCGGCAAATCTTGGTACGCAGTATTCTCGAGAATACTGCGTACCAAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147886    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058186.3-1043s1c1
Sequence:CCGGGAAGATGTCAATTAGCAGGAACTCGAGTTCCTGCTAATTGACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058186.3-486s1c1
Sequence:CCGGGTCAACTATGTAACTGGGAATCTCGAGATTCCCAGTTACATAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058186
FAM3B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 3, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058186.3-697s21c1
Sequence:CCGGTCAGGTCTAGCTGGGTATTTACTCGAGTAAATACCCAGCTAGACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058186.3-732s21c1
Sequence:CCGGTTGGAACTCCCTTCCGAAATTCTCGAGAATTTCGGAAGGGAGTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058186.3-928s21c1
Sequence:CCGGTAAATCCAACAGCCCATATTTCTCGAGAAATATGGGCTGTTGGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058186.3-770s1c1
Sequence:CCGGCCACTCTGATGCTAAGAACAACTCGAGTTGTTCTTAGCATCAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058186.3-767s1c1
Sequence:CCGGCAACCACTCTGATGCTAAGAACTCGAGTTCTTAGCATCAGAGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058186.3-418s1c1
Sequence:CCGGGCTTTGAGGATAACCTACTTACTCGAGTAAGTAGGTTATCCTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058186.3-999s1c1
Sequence:CCGGCAAATCTTGGTACGCAGTATTCTCGAGAATACTGCGTACCAAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147886    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058186.3-1043s1c1
Sequence:CCGGGAAGATGTCAATTAGCAGGAACTCGAGTTCCTGCTAATTGACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058186.3-486s1c1
Sequence:CCGGGTCAACTATGTAACTGGGAATCTCGAGATTCCCAGTTACATAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020622
FAM3B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 3, member B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020622.2-424s21c1
Sequence:CCGGACATTGCTGTCGTCAACTATGCTCGAGCATAGTTGACGACAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020622.2-217s21c1
Sequence:CCGGTCTACAACATCCGAAGCATTGCTCGAGCAATGCTTCGGATGTTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020622.2-370s21c1
Sequence:CCGGTTGAGGATGAAGTGCTAATAGCTCGAGCTATTAGCACTTCATCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020622.1-589s1c1
Sequence:CCGGGCTCAAGCAAAGGATGCCATACTCGAGTATGGCATCCTTTGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020622.1-691s1c1
Sequence:CCGGCCTTCAGAAATCGAGAGAGAACTCGAGTTCTCTCTCGATTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020622.1-212s1c1
Sequence:CCGGGCACTCTCTACAACATCCGAACTCGAGTTCGGATGTTGTAGAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020622.1-579s1c1
Sequence:CCGGCAAACTGAAGGCTCAAGCAAACTCGAGTTTGCTTGAGCCTTCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020622.1-720s1c1
Sequence:CCGGCCACTCAGATCAATCCAGGAACTCGAGTTCCTGGATTGATCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020622
FAM3B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 3, member B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020622.2-424s21c1
Sequence:CCGGACATTGCTGTCGTCAACTATGCTCGAGCATAGTTGACGACAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020622.2-217s21c1
Sequence:CCGGTCTACAACATCCGAAGCATTGCTCGAGCAATGCTTCGGATGTTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020622.2-370s21c1
Sequence:CCGGTTGAGGATGAAGTGCTAATAGCTCGAGCTATTAGCACTTCATCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020622.1-589s1c1
Sequence:CCGGGCTCAAGCAAAGGATGCCATACTCGAGTATGGCATCCTTTGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020622.1-691s1c1
Sequence:CCGGCCTTCAGAAATCGAGAGAGAACTCGAGTTCTCTCTCGATTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020622.1-212s1c1
Sequence:CCGGGCACTCTCTACAACATCCGAACTCGAGTTCGGATGTTGTAGAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020622.1-579s1c1
Sequence:CCGGCAAACTGAAGGCTCAAGCAAACTCGAGTTTGCTTGAGCCTTCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020622.1-720s1c1
Sequence:CCGGCCACTCAGATCAATCCAGGAACTCGAGTTCCTGGATTGATCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020622
FAM3B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 3, member B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020622.2-424s21c1
Sequence:CCGGACATTGCTGTCGTCAACTATGCTCGAGCATAGTTGACGACAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020622.2-217s21c1
Sequence:CCGGTCTACAACATCCGAAGCATTGCTCGAGCAATGCTTCGGATGTTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020622.2-370s21c1
Sequence:CCGGTTGAGGATGAAGTGCTAATAGCTCGAGCTATTAGCACTTCATCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020622.1-589s1c1
Sequence:CCGGGCTCAAGCAAAGGATGCCATACTCGAGTATGGCATCCTTTGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020622.1-691s1c1
Sequence:CCGGCCTTCAGAAATCGAGAGAGAACTCGAGTTCTCTCTCGATTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020622.1-212s1c1
Sequence:CCGGGCACTCTCTACAACATCCGAACTCGAGTTCGGATGTTGTAGAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020622.1-579s1c1
Sequence:CCGGCAAACTGAAGGCTCAAGCAAACTCGAGTTTGCTTGAGCCTTCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020622.1-720s1c1
Sequence:CCGGCCACTCAGATCAATCCAGGAACTCGAGTTCCTGGATTGATCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks