EMAIL THIS PAGE TO A FRIEND

FAM3C

family with sequence similarity 3, member C

125 Gene Product Result for
Synonyms: ILEI
UniProtKB ID: Q92520, A6NDN2, A8K3R7
Gene ID:
Human(10447) Summary: This gene is a member of the family with sequence similarity 3 (FAM3) family and encodes a secreted protein with a GG domain. A change in expression of this protein has been noted in pancreatic cancer-derived cells. [provided by RefSeq, Mar 2010]
Mouse(27999) family with sequence similarity 3, member C
Rat(312159) family with sequence similarity 3, member C
Zebrafish(334205) family with sequence similarity 3, member C
chicken(417758) family with sequence similarity 3, member C
cow(615690) family with sequence similarity 3, member C
domestic cat(101090506) family with sequence similarity 3, member C
dog(612336) family with sequence similarity 3, member C
sheep(101103469) family with sequence similarity 3, member C
naked mole-rat(101710121) family with sequence similarity 3, member C
domestic guinea pig(100735398) family with sequence similarity 3, member C
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1447 Human FAM3C ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138587 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138587 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138587 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014888 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107511 MISSION® esiRNA esiRNA human FAM3C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040020 Rosetta Predictions human pricing
NM_014888 Rosetta Predictions human pricing
NM_198771 Rosetta Predictions rat pricing
NM_138587 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053865 predicted 546
2 SASI_Hs01_00053866 predicted 657
3 SASI_Hs01_00053867 predicted 939
4 SASI_Hs01_00053868 predicted 1123
5 SASI_Hs01_00053869 predicted 1045
6 SASI_Hs01_00053870 predicted 900
7 SASI_Hs01_00053872 predicted 624
8 SASI_Hs01_00053873 predicted 362
9 SASI_Hs01_00053874 predicted 1030
10 SASI_Hs02_00308760 predicted 929
11 SASI_Hs01_00053871 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078272 predicted 586
2 SASI_Hs01_00078273 predicted 694
3 SASI_Hs01_00078274 predicted 975
4 SASI_Hs01_00078275 predicted 1169
5 SASI_Hs01_00078276 predicted 1081
6 SASI_Hs01_00078277 predicted 944
7 SASI_Hs01_00078279 predicted 659
8 SASI_Hs01_00078280 predicted 401
9 SASI_Hs01_00078281 predicted 1069
10 SASI_Hs02_00346513 predicted 965
11 SASI_Hs01_00078278 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046291 predicted 919
2 SASI_Rn01_00046292 predicted 1046
3 SASI_Rn01_00046293 predicted 219
4 SASI_Rn01_00046294 predicted 928
5 SASI_Rn02_00270019 predicted 946
6 SASI_Rn01_00046295 predicted 289
7 SASI_Rn01_00046296 predicted 421
8 SASI_Rn01_00046297 predicted 1053
9 SASI_Rn01_00046298 predicted 647
10 SASI_Rn01_00046299 predicted 988
11 SASI_Rn01_00046300 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138587 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134020 predicted 645
2 SASI_Mm01_00134022 predicted 1051
3 SASI_Mm01_00134023 predicted 289
4 SASI_Mm01_00134024 predicted 1104
5 SASI_Mm01_00134026 predicted 576
6 SASI_Mm01_00134027 predicted 930
7 SASI_Mm01_00134028 predicted 995
8 SASI_Mm01_00134029 predicted 721
9 SASI_Mm02_00339643 predicted 435
10 SASI_Mm02_00339644 predicted 218
11 SASI_Mm01_00134021 predicted 547
12 SASI_Mm01_00134025 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138587
VALIDATED
FAM3C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 3, member C
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138587.3-734s1c1
Sequence:CCGGCAATAAGGAAACGAACAAGTACTCGAGTACTTGTTCGTTTCCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138587.3-513s1c1
Sequence:CCGGGTGGCACCATTCATTGAGTTTCTCGAGAAACTCAATGAATGGTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138587.3-717s1c1
Sequence:CCGGGAACAGCACATAAAGAACAATCTCGAGATTGTTCTTTATGTGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138587.3-171s1c1
Sequence:CCGGGTATTCTTACTGACCTTCTATCTCGAGATAGAAGGTCAGTAAGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138587.3-222s1c1
Sequence:CCGGGATGCAAGTTTAGGAAATCTACTCGAGTAGATTTCCTAAACTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138587.3-293s1c1
Sequence:CCGGGTACAAGTGTGGGATCTCAAACTCGAGTTTGAGATCCCACACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138587.3-1848s1c1
Sequence:CCGGCCACTTCAAATGCAACATAAACTCGAGTTTATGTTGCATTTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138587.3-2028s1c1
Sequence:CCGGCGCTACTGTTTCTCTCCTCAACTCGAGTTGAGGAGAGAAACAGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138587.4-171s21c1
Sequence:CCGGGTATTCTTACTGACCTTCTATCTCGAGATAGAAGGTCAGTAAGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138587.4-222s21c1
Sequence:CCGGGATGCAAGTTTAGGAAATCTACTCGAGTAGATTTCCTAAACTTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138587.4-471s1c1
Sequence:CCGGGAAGTAATAGACACCAAATTTCTCGAGAAATTTGGTGTCTATTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138587.4-937s21c1
Sequence:CCGGCTGTCGATTCCAGGATTATTTCTCGAGAAATAATCCTGGAATCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138587.4-650s21c1
Sequence:CCGGCAGTCTTGGTTTCCGAGATAACTCGAGTTATCTCGGAAACCAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138587.4-717s21c1
Sequence:CCGGGAACAGCACATAAAGAACAATCTCGAGATTGTTCTTTATGTGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138587
VALIDATED
FAM3C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 3, member C
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138587.3-734s1c1
Sequence:CCGGCAATAAGGAAACGAACAAGTACTCGAGTACTTGTTCGTTTCCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138587.3-513s1c1
Sequence:CCGGGTGGCACCATTCATTGAGTTTCTCGAGAAACTCAATGAATGGTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138587.3-717s1c1
Sequence:CCGGGAACAGCACATAAAGAACAATCTCGAGATTGTTCTTTATGTGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138587.3-171s1c1
Sequence:CCGGGTATTCTTACTGACCTTCTATCTCGAGATAGAAGGTCAGTAAGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138587.3-222s1c1
Sequence:CCGGGATGCAAGTTTAGGAAATCTACTCGAGTAGATTTCCTAAACTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138587.3-293s1c1
Sequence:CCGGGTACAAGTGTGGGATCTCAAACTCGAGTTTGAGATCCCACACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138587.3-1848s1c1
Sequence:CCGGCCACTTCAAATGCAACATAAACTCGAGTTTATGTTGCATTTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138587.3-2028s1c1
Sequence:CCGGCGCTACTGTTTCTCTCCTCAACTCGAGTTGAGGAGAGAAACAGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138587.4-171s21c1
Sequence:CCGGGTATTCTTACTGACCTTCTATCTCGAGATAGAAGGTCAGTAAGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138587.4-222s21c1
Sequence:CCGGGATGCAAGTTTAGGAAATCTACTCGAGTAGATTTCCTAAACTTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138587.4-471s1c1
Sequence:CCGGGAAGTAATAGACACCAAATTTCTCGAGAAATTTGGTGTCTATTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138587.4-937s21c1
Sequence:CCGGCTGTCGATTCCAGGATTATTTCTCGAGAAATAATCCTGGAATCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138587.4-650s21c1
Sequence:CCGGCAGTCTTGGTTTCCGAGATAACTCGAGTTATCTCGGAAACCAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138587.4-717s21c1
Sequence:CCGGGAACAGCACATAAAGAACAATCTCGAGATTGTTCTTTATGTGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138587
VALIDATED
FAM3C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 3, member C
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138587.3-734s1c1
Sequence:CCGGCAATAAGGAAACGAACAAGTACTCGAGTACTTGTTCGTTTCCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138587.3-513s1c1
Sequence:CCGGGTGGCACCATTCATTGAGTTTCTCGAGAAACTCAATGAATGGTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138587.3-717s1c1
Sequence:CCGGGAACAGCACATAAAGAACAATCTCGAGATTGTTCTTTATGTGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138587.3-171s1c1
Sequence:CCGGGTATTCTTACTGACCTTCTATCTCGAGATAGAAGGTCAGTAAGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138587.3-222s1c1
Sequence:CCGGGATGCAAGTTTAGGAAATCTACTCGAGTAGATTTCCTAAACTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138587.3-293s1c1
Sequence:CCGGGTACAAGTGTGGGATCTCAAACTCGAGTTTGAGATCCCACACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138587.3-1848s1c1
Sequence:CCGGCCACTTCAAATGCAACATAAACTCGAGTTTATGTTGCATTTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138587.3-2028s1c1
Sequence:CCGGCGCTACTGTTTCTCTCCTCAACTCGAGTTGAGGAGAGAAACAGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138587.4-171s21c1
Sequence:CCGGGTATTCTTACTGACCTTCTATCTCGAGATAGAAGGTCAGTAAGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138587.4-222s21c1
Sequence:CCGGGATGCAAGTTTAGGAAATCTACTCGAGTAGATTTCCTAAACTTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138587.4-471s1c1
Sequence:CCGGGAAGTAATAGACACCAAATTTCTCGAGAAATTTGGTGTCTATTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138587.4-937s21c1
Sequence:CCGGCTGTCGATTCCAGGATTATTTCTCGAGAAATAATCCTGGAATCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138587.4-650s21c1
Sequence:CCGGCAGTCTTGGTTTCCGAGATAACTCGAGTTATCTCGGAAACCAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138587.4-717s21c1
Sequence:CCGGGAACAGCACATAAAGAACAATCTCGAGATTGTTCTTTATGTGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014888
VALIDATED
FAM3C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 3, member C
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014888.1-1767s1c1
Sequence:CCGGCCTGTGTTTATCTAACTTCATCTCGAGATGAAGTTAGATAAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014888.1-261s1c1
Sequence:CCGGGATGCAAGTTTAGGAAATCTACTCGAGTAGATTTCCTAAACTTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014888.1-328s1c1
Sequence:CCGGCCAGATATAAGTGTGGGATCTCTCGAGAGATCCCACACTTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014888.1-579s1c1
Sequence:CCGGGCCATACAAGATGGAACAATACTCGAGTATTGTTCCATCTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014888.1-506s1c1
Sequence:CCGGAGGAGAAGTATTAGACACTAACTCGAGTTAGTGTCTAATACTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014888.2-544s21c1
Sequence:CCGGATGTTGGAAGAGGGATCAATGCTCGAGCATTGATCCCTCTTCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014888.2-660s21c1
Sequence:CCGGGCCATACAAGATGGAACAATACTCGAGTATTGTTCCATCTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014888.2-625s21c1
Sequence:CCGGGAGGAGATGTGGCACCATTTACTCGAGTAAATGGTGCCACATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_014888.2-753s21c1
Sequence:CCGGGGGAGCACATCTATTACTAATCTCGAGATTAGTAATAGATGTGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014888.2-1033s21c1
Sequence:CCGGCTTGGTGTGTGCATGAGTATTCTCGAGAATACTCATGCACACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014888
VALIDATED
FAM3C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 3, member C
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014888.1-1767s1c1
Sequence:CCGGCCTGTGTTTATCTAACTTCATCTCGAGATGAAGTTAGATAAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014888.1-261s1c1
Sequence:CCGGGATGCAAGTTTAGGAAATCTACTCGAGTAGATTTCCTAAACTTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014888.1-328s1c1
Sequence:CCGGCCAGATATAAGTGTGGGATCTCTCGAGAGATCCCACACTTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014888.1-579s1c1
Sequence:CCGGGCCATACAAGATGGAACAATACTCGAGTATTGTTCCATCTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014888.1-506s1c1
Sequence:CCGGAGGAGAAGTATTAGACACTAACTCGAGTTAGTGTCTAATACTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014888.2-544s21c1
Sequence:CCGGATGTTGGAAGAGGGATCAATGCTCGAGCATTGATCCCTCTTCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014888.2-660s21c1
Sequence:CCGGGCCATACAAGATGGAACAATACTCGAGTATTGTTCCATCTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014888.2-625s21c1
Sequence:CCGGGAGGAGATGTGGCACCATTTACTCGAGTAAATGGTGCCACATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_014888.2-753s21c1
Sequence:CCGGGGGAGCACATCTATTACTAATCTCGAGATTAGTAATAGATGTGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014888.2-1033s21c1
Sequence:CCGGCTTGGTGTGTGCATGAGTATTCTCGAGAATACTCATGCACACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014888
VALIDATED
FAM3C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 3, member C
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014888.1-1767s1c1
Sequence:CCGGCCTGTGTTTATCTAACTTCATCTCGAGATGAAGTTAGATAAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014888.1-261s1c1
Sequence:CCGGGATGCAAGTTTAGGAAATCTACTCGAGTAGATTTCCTAAACTTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014888.1-328s1c1
Sequence:CCGGCCAGATATAAGTGTGGGATCTCTCGAGAGATCCCACACTTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014888.1-579s1c1
Sequence:CCGGGCCATACAAGATGGAACAATACTCGAGTATTGTTCCATCTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014888.1-506s1c1
Sequence:CCGGAGGAGAAGTATTAGACACTAACTCGAGTTAGTGTCTAATACTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014888.2-544s21c1
Sequence:CCGGATGTTGGAAGAGGGATCAATGCTCGAGCATTGATCCCTCTTCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014888.2-660s21c1
Sequence:CCGGGCCATACAAGATGGAACAATACTCGAGTATTGTTCCATCTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014888.2-625s21c1
Sequence:CCGGGAGGAGATGTGGCACCATTTACTCGAGTAAATGGTGCCACATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_014888.2-753s21c1
Sequence:CCGGGGGAGCACATCTATTACTAATCTCGAGATTAGTAATAGATGTGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014888.2-1033s21c1
Sequence:CCGGCTTGGTGTGTGCATGAGTATTCTCGAGAATACTCATGCACACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks