EMAIL THIS PAGE TO A FRIEND

FAM43A

family with sequence similarity 43, member A

UniProtKB ID: Q8N2R8, A3KME2, Q8IXP4, Q8WZ07
Gene ID:
Mouse(224093) family with sequence similarity 43, member A
Rat(288031) family with sequence similarity 43, member A
Zebrafish(334166) family with sequence similarity 43, member A
cow(539374) family with sequence similarity 43, member A
domestic cat(101089711) family with sequence similarity 43, member A
dog(100683256) family with sequence similarity 43, member A
chicken(429145) family with sequence similarity 43, member A
sheep(101105543) family with sequence similarity 43, member A
naked mole-rat(101725694) family with sequence similarity 43, member A
domestic guinea pig(100719355) family with sequence similarity 43, member A
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177632 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177632 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177632 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153690 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153690 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153690 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU019121 MISSION® esiRNA esiRNA targeting mouse Fam43a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153690 Rosetta Predictions human pricing
NM_001039002 Rosetta Predictions rat pricing
NM_177632 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199434 predicted 1135
2 SASI_Hs01_00199435 predicted 2308
3 SASI_Hs01_00199436 predicted 1200
4 SASI_Hs01_00199437 predicted 1199
5 SASI_Hs01_00199438 predicted 1599
6 SASI_Hs01_00199439 predicted 1212
7 SASI_Hs01_00199440 predicted 1634
8 SASI_Hs01_00199441 predicted 1392
9 SASI_Hs01_00199442 predicted 1133
10 SASI_Hs01_00199443 predicted 1390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080812 predicted 797
2 SASI_Rn01_00080813 predicted 1326
3 SASI_Rn01_00080814 predicted 1697
4 SASI_Rn01_00080815 predicted 1768
5 SASI_Rn01_00080816 predicted 506
6 SASI_Rn01_00080817 predicted 1510
7 SASI_Rn02_00204724 predicted 1924
8 SASI_Rn02_00204725 predicted 1648
9 SASI_Rn01_00080819 predicted 1711
10 SASI_Rn01_00080820 predicted 538
11 SASI_Rn01_00080818 predicted 496
12 SASI_Rn01_00080821 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164875 predicted 1139
2 SASI_Mm01_00164876 predicted 2284
3 SASI_Mm01_00164877 predicted 1930
4 SASI_Mm01_00164879 predicted 1962
5 SASI_Mm01_00164880 predicted 1181
6 SASI_Mm01_00164881 predicted 926
7 SASI_Mm01_00164882 predicted 1078
8 SASI_Mm01_00164883 predicted 1356
9 SASI_Mm02_00347873 predicted 1184
10 SASI_Mm01_00164884 predicted 1929
11 SASI_Mm01_00164878 predicted 1155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177632
VALIDATED
FAM43A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 43, member A
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177632.2-1966s1c1
Sequence:CCGGCCTTAGCTTTGGCAATGACGTCTCGAGACGTCATTGCCAAAGCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177632.2-2637s1c1
Sequence:CCGGGCTGTTTACCTCAGACTCAAACTCGAGTTTGAGTCTGAGGTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177632.2-1893s1c1
Sequence:CCGGCATCACTTCCTCTGTCAGTCTCTCGAGAGACTGACAGAGGAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177632.2-2645s1c1
Sequence:CCGGCCTCAGACTCAAACTCTTGAACTCGAGTTCAAGAGTTTGAGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177632.2-2708s1c1
Sequence:CCGGGCAGTGTATGAAAGTCGTGTTCTCGAGAACACGACTTTCATACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177632.2-1997s1c1
Sequence:CCGGGAGACCGATTTAAGGGTGACACTCGAGTGTCACCCTTAAATCGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177632.3-2645s21c1
Sequence:CCGGCCTCAGACTCAAACTCTTGAACTCGAGTTCAAGAGTTTGAGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177632.3-1966s21c1
Sequence:CCGGCCTTAGCTTTGGCAATGACGTCTCGAGACGTCATTGCCAAAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177632.3-2637s21c1
Sequence:CCGGGCTGTTTACCTCAGACTCAAACTCGAGTTTGAGTCTGAGGTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177632.3-1893s21c1
Sequence:CCGGCATCACTTCCTCTGTCAGTCTCTCGAGAGACTGACAGAGGAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177632.2-1933s1c1
Sequence:CCGGCCAACTGTCACAGCTTATTAGCTCGAGCTAATAAGCTGTGACAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177632.3-2707s21c1
Sequence:CCGGGCAGTGTATGAAAGTCGTGTTCTCGAGAACACGACTTTCATACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177632
VALIDATED
FAM43A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 43, member A
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177632.2-1966s1c1
Sequence:CCGGCCTTAGCTTTGGCAATGACGTCTCGAGACGTCATTGCCAAAGCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177632.2-2637s1c1
Sequence:CCGGGCTGTTTACCTCAGACTCAAACTCGAGTTTGAGTCTGAGGTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177632.2-1893s1c1
Sequence:CCGGCATCACTTCCTCTGTCAGTCTCTCGAGAGACTGACAGAGGAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177632.2-2645s1c1
Sequence:CCGGCCTCAGACTCAAACTCTTGAACTCGAGTTCAAGAGTTTGAGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177632.2-2708s1c1
Sequence:CCGGGCAGTGTATGAAAGTCGTGTTCTCGAGAACACGACTTTCATACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177632.2-1997s1c1
Sequence:CCGGGAGACCGATTTAAGGGTGACACTCGAGTGTCACCCTTAAATCGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177632.3-2645s21c1
Sequence:CCGGCCTCAGACTCAAACTCTTGAACTCGAGTTCAAGAGTTTGAGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177632.3-1966s21c1
Sequence:CCGGCCTTAGCTTTGGCAATGACGTCTCGAGACGTCATTGCCAAAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177632.3-2637s21c1
Sequence:CCGGGCTGTTTACCTCAGACTCAAACTCGAGTTTGAGTCTGAGGTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177632.3-1893s21c1
Sequence:CCGGCATCACTTCCTCTGTCAGTCTCTCGAGAGACTGACAGAGGAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177632.2-1933s1c1
Sequence:CCGGCCAACTGTCACAGCTTATTAGCTCGAGCTAATAAGCTGTGACAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177632.3-2707s21c1
Sequence:CCGGGCAGTGTATGAAAGTCGTGTTCTCGAGAACACGACTTTCATACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177632
VALIDATED
FAM43A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 43, member A
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177632.2-1966s1c1
Sequence:CCGGCCTTAGCTTTGGCAATGACGTCTCGAGACGTCATTGCCAAAGCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177632.2-2637s1c1
Sequence:CCGGGCTGTTTACCTCAGACTCAAACTCGAGTTTGAGTCTGAGGTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177632.2-1893s1c1
Sequence:CCGGCATCACTTCCTCTGTCAGTCTCTCGAGAGACTGACAGAGGAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177632.2-2645s1c1
Sequence:CCGGCCTCAGACTCAAACTCTTGAACTCGAGTTCAAGAGTTTGAGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177632.2-2708s1c1
Sequence:CCGGGCAGTGTATGAAAGTCGTGTTCTCGAGAACACGACTTTCATACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177632.2-1997s1c1
Sequence:CCGGGAGACCGATTTAAGGGTGACACTCGAGTGTCACCCTTAAATCGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177632.3-2645s21c1
Sequence:CCGGCCTCAGACTCAAACTCTTGAACTCGAGTTCAAGAGTTTGAGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177632.3-1966s21c1
Sequence:CCGGCCTTAGCTTTGGCAATGACGTCTCGAGACGTCATTGCCAAAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177632.3-2637s21c1
Sequence:CCGGGCTGTTTACCTCAGACTCAAACTCGAGTTTGAGTCTGAGGTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177632.3-1893s21c1
Sequence:CCGGCATCACTTCCTCTGTCAGTCTCTCGAGAGACTGACAGAGGAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177632.2-1933s1c1
Sequence:CCGGCCAACTGTCACAGCTTATTAGCTCGAGCTAATAAGCTGTGACAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177632.3-2707s21c1
Sequence:CCGGGCAGTGTATGAAAGTCGTGTTCTCGAGAACACGACTTTCATACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153690
VALIDATED
FAM43A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 43, member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153690.4-2617s1c1
Sequence:CCGGGCTGTCACTGACATCTCATTACTCGAGTAATGAGATGTCAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153690.4-1135s1c1
Sequence:CCGGCCCAACTTACACCGTGCTCTACTCGAGTAGAGCACGGTGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153690.4-1414s1c1
Sequence:CCGGGCTGAAGCACAAGGCCGTGATCTCGAGATCACGGCCTTGTGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153690.4-1993s1c1
Sequence:CCGGGTCGCAACTTATTAGCGACCTCTCGAGAGGTCGCTAATAAGTTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153690.4-1870s1c1
Sequence:CCGGCTTGTTGGATACTCTGGAGAACTCGAGTTCTCCAGAGTATCCAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153690.4-1513s21c1
Sequence:CCGGCAACGCGCTGGCGGAATTTAACTCGAGTTAAATTCCGCCAGCGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153690.4-2682s21c1
Sequence:CCGGCAACCCTTTAGCCCTTGGTTCCTCGAGGAACCAAGGGCTAAAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153690.4-2500s21c1
Sequence:CCGGGGCTGAAGTTCCTAGTCTCAGCTCGAGCTGAGACTAGGAACTTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153690.4-1104s21c1
Sequence:CCGGAGCGCAAGAAGCTGCACATCACTCGAGTGATGTGCAGCTTCTTGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153690.4-1629s21c1
Sequence:CCGGACGGACCCTGCTGCTATAAACCTCGAGGTTTATAGCAGCAGGGTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153690
VALIDATED
FAM43A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 43, member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153690.4-2617s1c1
Sequence:CCGGGCTGTCACTGACATCTCATTACTCGAGTAATGAGATGTCAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153690.4-1135s1c1
Sequence:CCGGCCCAACTTACACCGTGCTCTACTCGAGTAGAGCACGGTGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153690.4-1414s1c1
Sequence:CCGGGCTGAAGCACAAGGCCGTGATCTCGAGATCACGGCCTTGTGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153690.4-1993s1c1
Sequence:CCGGGTCGCAACTTATTAGCGACCTCTCGAGAGGTCGCTAATAAGTTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153690.4-1870s1c1
Sequence:CCGGCTTGTTGGATACTCTGGAGAACTCGAGTTCTCCAGAGTATCCAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153690.4-1513s21c1
Sequence:CCGGCAACGCGCTGGCGGAATTTAACTCGAGTTAAATTCCGCCAGCGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153690.4-2682s21c1
Sequence:CCGGCAACCCTTTAGCCCTTGGTTCCTCGAGGAACCAAGGGCTAAAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153690.4-2500s21c1
Sequence:CCGGGGCTGAAGTTCCTAGTCTCAGCTCGAGCTGAGACTAGGAACTTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153690.4-1104s21c1
Sequence:CCGGAGCGCAAGAAGCTGCACATCACTCGAGTGATGTGCAGCTTCTTGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153690.4-1629s21c1
Sequence:CCGGACGGACCCTGCTGCTATAAACCTCGAGGTTTATAGCAGCAGGGTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153690
VALIDATED
FAM43A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 43, member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153690.4-2617s1c1
Sequence:CCGGGCTGTCACTGACATCTCATTACTCGAGTAATGAGATGTCAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153690.4-1135s1c1
Sequence:CCGGCCCAACTTACACCGTGCTCTACTCGAGTAGAGCACGGTGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153690.4-1414s1c1
Sequence:CCGGGCTGAAGCACAAGGCCGTGATCTCGAGATCACGGCCTTGTGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153690.4-1993s1c1
Sequence:CCGGGTCGCAACTTATTAGCGACCTCTCGAGAGGTCGCTAATAAGTTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153690.4-1870s1c1
Sequence:CCGGCTTGTTGGATACTCTGGAGAACTCGAGTTCTCCAGAGTATCCAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153690.4-1513s21c1
Sequence:CCGGCAACGCGCTGGCGGAATTTAACTCGAGTTAAATTCCGCCAGCGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153690.4-2682s21c1
Sequence:CCGGCAACCCTTTAGCCCTTGGTTCCTCGAGGAACCAAGGGCTAAAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153690.4-2500s21c1
Sequence:CCGGGGCTGAAGTTCCTAGTCTCAGCTCGAGCTGAGACTAGGAACTTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153690.4-1104s21c1
Sequence:CCGGAGCGCAAGAAGCTGCACATCACTCGAGTGATGTGCAGCTTCTTGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153690.4-1629s21c1
Sequence:CCGGACGGACCCTGCTGCTATAAACCTCGAGGTTTATAGCAGCAGGGTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks