EMAIL THIS PAGE TO A FRIEND

FAM43B

family with sequence similarity 43, member B

UniProtKB ID: Q6ZT52, A5PL01
Gene ID:
Mouse(625638) family with sequence similarity 43, member B
Rat(313650) family with sequence similarity 43, member B
domestic guinea pig(101787196) family with sequence similarity 43, member B
naked mole-rat(101713116) family with sequence similarity 43, member B
sheep(101102630) family with sequence similarity 43, member B
Zebrafish(447808) family with sequence similarity 43, member B
cow(100298683) family with sequence similarity 43, member B
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081672 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081672 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081672 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207334 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207334 Rosetta Predictions human pricing
XM_001070592 Rosetta Predictions rat pricing
XM_233583 Rosetta Predictions rat pricing
NM_001081672 Rosetta Predictions mouse pricing
XM_890212 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228582 predicted 734
2 SASI_Hs01_00228588 predicted 707
3 SASI_Hs01_00228583 predicted 996
4 SASI_Hs01_00228584 predicted 741
5 SASI_Hs01_00228585 predicted 952
6 SASI_Hs01_00228586 predicted 1032
7 SASI_Hs01_00228587 predicted 609
8 SASI_Hs01_00228590 predicted 1676
9 SASI_Hs02_00373880 predicted 1726
10 SASI_Hs01_00228591 predicted 2014
11 SASI_Hs01_00228589 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332165 predicted 690
2 SASI_Rn02_00332166 predicted 567
3 SASI_Rn02_00332167 predicted 563
4 SASI_Rn02_00332168 predicted 897
5 SASI_Rn02_00332169 predicted 623
6 SASI_Rn02_00332170 predicted 899
7 SASI_Rn02_00332171 predicted 867
8 SASI_Rn02_00332172 predicted 715
9 SASI_Rn02_00332173 predicted 790
10 SASI_Rn02_00332174 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387887 predicted 686
2 SASI_Rn02_00387888 predicted 568
3 SASI_Rn02_00387889 predicted 562
4 SASI_Rn02_00387890 predicted 902
5 SASI_Rn02_00387891 predicted 628
6 SASI_Rn02_00387892 predicted 907
7 SASI_Rn02_00387893 predicted 866
8 SASI_Rn02_00387894 predicted 718
9 SASI_Rn02_00387895 predicted 789
10 SASI_Rn02_00387896 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298945 predicted 833
2 SASI_Mm02_00298946 predicted 729
3 SASI_Mm02_00298947 predicted 934
4 SASI_Mm02_00298948 predicted 593
5 SASI_Mm02_00298949 predicted 537
6 SASI_Mm02_00298950 predicted 1792
7 SASI_Mm02_00298951 predicted 1662
8 SASI_Mm02_00298952 predicted 1554
9 SASI_Mm02_00298953 predicted 1903
10 SASI_Mm02_00298954 predicted 1645
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_890212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270690 predicted 465
2 SASI_Mm01_00270691 predicted 1733
3 SASI_Mm01_00270692 predicted 1602
4 SASI_Mm01_00270693 predicted 1488
5 SASI_Mm01_00270694 predicted 1830
6 SASI_Mm01_00270695 predicted 1931
7 SASI_Mm01_00270696 predicted 1578
8 SASI_Mm01_00270697 predicted 1806
9 SASI_Mm01_00270698 predicted 1855
10 SASI_Mm01_00270699 predicted 1702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081672
FAM43B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 43, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081672.1-1236s21c1
Sequence:CCGGCTCAACGCCAAGTGCGCTTACCTCGAGGTAAGCGCACTTGGCGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081672.1-839s21c1
Sequence:CCGGGGGCACGAAGATGAAACTGACCTCGAGGTCAGTTTCATCTTCGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081672.1-796s21c1
Sequence:CCGGACGACGCTGTGGGCAGGATTTCTCGAGAAATCCTGCCCACAGCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081672.1-698s21c1
Sequence:CCGGGCGCCAGAAAGTGGAGCTTAACTCGAGTTAAGCTCCACTTTCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081672.1-1670s21c1
Sequence:CCGGAGTAGGATATGCCCTTAATTTCTCGAGAAATTAAGGGCATATCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081672
FAM43B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 43, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081672.1-1236s21c1
Sequence:CCGGCTCAACGCCAAGTGCGCTTACCTCGAGGTAAGCGCACTTGGCGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081672.1-839s21c1
Sequence:CCGGGGGCACGAAGATGAAACTGACCTCGAGGTCAGTTTCATCTTCGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081672.1-796s21c1
Sequence:CCGGACGACGCTGTGGGCAGGATTTCTCGAGAAATCCTGCCCACAGCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081672.1-698s21c1
Sequence:CCGGGCGCCAGAAAGTGGAGCTTAACTCGAGTTAAGCTCCACTTTCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081672.1-1670s21c1
Sequence:CCGGAGTAGGATATGCCCTTAATTTCTCGAGAAATTAAGGGCATATCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081672
FAM43B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 43, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081672.1-1236s21c1
Sequence:CCGGCTCAACGCCAAGTGCGCTTACCTCGAGGTAAGCGCACTTGGCGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081672.1-839s21c1
Sequence:CCGGGGGCACGAAGATGAAACTGACCTCGAGGTCAGTTTCATCTTCGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081672.1-796s21c1
Sequence:CCGGACGACGCTGTGGGCAGGATTTCTCGAGAAATCCTGCCCACAGCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081672.1-698s21c1
Sequence:CCGGGCGCCAGAAAGTGGAGCTTAACTCGAGTTAAGCTCCACTTTCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081672.1-1670s21c1
Sequence:CCGGAGTAGGATATGCCCTTAATTTCTCGAGAAATTAAGGGCATATCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207334
FAM43B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 43, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207334.1-715s1c1
Sequence:CCGGCCAGAAAGTGGAGCTCAACAACTCGAGTTGTTGAGCTCCACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207334.1-2032s1c1
Sequence:CCGGGCTATACACACAGGGAGGAATCTCGAGATTCCTCCCTGTGTGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184518    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207334.1-2338s1c1
Sequence:CCGGGCTTAGGACACTGACTACCTACTCGAGTAGGTAGTCAGTGTCCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207334.1-2140s1c1
Sequence:CCGGCCGACGTTCAAACAACAGGTTCTCGAGAACCTGTTGTTTGAACGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207334.1-718s1c1
Sequence:CCGGGAAAGTGGAGCTCAACAAGGACTCGAGTCCTTGTTGAGCTCCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207334
FAM43B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 43, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207334.1-715s1c1
Sequence:CCGGCCAGAAAGTGGAGCTCAACAACTCGAGTTGTTGAGCTCCACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207334.1-2032s1c1
Sequence:CCGGGCTATACACACAGGGAGGAATCTCGAGATTCCTCCCTGTGTGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184518    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207334.1-2338s1c1
Sequence:CCGGGCTTAGGACACTGACTACCTACTCGAGTAGGTAGTCAGTGTCCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207334.1-2140s1c1
Sequence:CCGGCCGACGTTCAAACAACAGGTTCTCGAGAACCTGTTGTTTGAACGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207334.1-718s1c1
Sequence:CCGGGAAAGTGGAGCTCAACAAGGACTCGAGTCCTTGTTGAGCTCCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207334
FAM43B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 43, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207334.1-715s1c1
Sequence:CCGGCCAGAAAGTGGAGCTCAACAACTCGAGTTGTTGAGCTCCACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207334.1-2032s1c1
Sequence:CCGGGCTATACACACAGGGAGGAATCTCGAGATTCCTCCCTGTGTGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184518    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207334.1-2338s1c1
Sequence:CCGGGCTTAGGACACTGACTACCTACTCGAGTAGGTAGTCAGTGTCCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207334.1-2140s1c1
Sequence:CCGGCCGACGTTCAAACAACAGGTTCTCGAGAACCTGTTGTTTGAACGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207334.1-718s1c1
Sequence:CCGGGAAAGTGGAGCTCAACAAGGACTCGAGTCCTTGTTGAGCTCCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks