EMAIL THIS PAGE TO A FRIEND

FAM45A

family with sequence similarity 45, member A

47 Gene Product Result for
UniProtKB ID: Q8TCE6, B1AMV6, B4DDC3, D3DRC8, Q9NXW4
Gene ID:
Mouse(67894) family with sequence similarity 45, member A
Rat(308009) family with sequence similarity 45, member A
Zebrafish(556203) family with sequence similarity 45, member A
chicken(423928) family with sequence similarity 45, member A
cow(534370) family with sequence similarity 45, member A
domestic cat(101088191) family with sequence similarity 45, member A
dog(477837) family with sequence similarity 45, member A
sheep(101106220) family with sequence similarity 45, member A
naked mole-rat(101719786) family with sequence similarity 45, member A
domestic guinea pig(100716960) family with sequence similarity 45, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026437 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026437 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026437 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207009 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207009 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207009 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207009 Rosetta Predictions human pricing
NM_001127681 Rosetta Predictions rat pricing
NM_026437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052538 predicted 1126
2 SASI_Hs01_00052539 predicted 440
3 SASI_Hs01_00052540 predicted 728
4 SASI_Hs01_00052541 predicted 369
5 SASI_Hs01_00052542 predicted 1070
6 SASI_Hs01_00052543 predicted 531
7 SASI_Hs01_00052545 predicted 1044
8 SASI_Hs01_00052546 predicted 1123
9 SASI_Hs02_00373702 predicted 380
10 SASI_Hs01_00052547 predicted 930
11 SASI_Hs01_00052544 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127681 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254840 predicted 761
2 SASI_Rn02_00254841 predicted 939
3 SASI_Rn02_00254842 predicted 866
4 SASI_Rn02_00254843 predicted 561
5 SASI_Rn02_00254844 predicted 1208
6 SASI_Rn02_00254845 predicted 1061
7 SASI_Rn02_00254846 predicted 1046
8 SASI_Rn02_00254847 predicted 741
9 SASI_Rn02_00254848 predicted 427
10 SASI_Rn02_00254849 predicted 1204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023387 predicted 699
2 SASI_Mm01_00023388 predicted 1120
3 SASI_Mm01_00023389 predicted 323
4 SASI_Mm01_00023391 predicted 1147
5 SASI_Mm01_00023392 predicted 1156
6 SASI_Mm01_00023393 predicted 683
7 SASI_Mm01_00023394 predicted 641
8 SASI_Mm01_00023395 predicted 824
9 SASI_Mm01_00023396 predicted 631
10 SASI_Mm02_00330264 predicted 720
11 SASI_Mm01_00023390 predicted 1010
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026437
VALIDATED
FAM45A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 45, member A
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026437.1-882s1c1
Sequence:CCGGGAAATCAGACAGCCAGGTTATCTCGAGATAACCTGGCTGTCTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026437.1-760s1c1
Sequence:CCGGGTGTTTGTGAATCTGGCAGATCTCGAGATCTGCCAGATTCACAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026437.1-832s1c1
Sequence:CCGGCTGCATAAAGAGATTGGTCAACTCGAGTTGACCAATCTCTTTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026437.1-1867s1c1
Sequence:CCGGCCAGCCCATAATGCTTTCATACTCGAGTATGAAAGCATTATGGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026437.1-502s1c1
Sequence:CCGGCAATTTGGAATGGAAACTGTTCTCGAGAACAGTTTCCATTCCAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026437.1-649s1c1
Sequence:CCGGCATTCTTACATGCACCTTCATCTCGAGATGAAGGTGCATGTAAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026437.1-745s1c1
Sequence:CCGGCCAGACCTCTATGACGTGTTTCTCGAGAAACACGTCATAGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026437.2-1049s21c1
Sequence:CCGGTCTAGCAGCAGCTGAACAAATCTCGAGATTTGTTCAGCTGCTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026437.2-836s21c1
Sequence:CCGGTAAAGAGATTGGTCAACTAATCTCGAGATTAGTTGACCAATCTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026437.2-745s21c1
Sequence:CCGGCAGACCTCTATGACGTGTTTGCTCGAGCAAACACGTCATAGAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026437.2-315s21c1
Sequence:CCGGGCCGCCTTCACTAGGATATTGCTCGAGCAATATCCTAGTGAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026437.2-1129s21c1
Sequence:CCGGTCCTAGTACCCATTGACATTACTCGAGTAATGTCAATGGGTACTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026437.2-479s1c1
Sequence:CCGGCTCCATCAAAGACATTGTATCCTCGAGGATACAATGTCTTTGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026437
VALIDATED
FAM45A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 45, member A
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026437.1-882s1c1
Sequence:CCGGGAAATCAGACAGCCAGGTTATCTCGAGATAACCTGGCTGTCTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026437.1-760s1c1
Sequence:CCGGGTGTTTGTGAATCTGGCAGATCTCGAGATCTGCCAGATTCACAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026437.1-832s1c1
Sequence:CCGGCTGCATAAAGAGATTGGTCAACTCGAGTTGACCAATCTCTTTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026437.1-1867s1c1
Sequence:CCGGCCAGCCCATAATGCTTTCATACTCGAGTATGAAAGCATTATGGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026437.1-502s1c1
Sequence:CCGGCAATTTGGAATGGAAACTGTTCTCGAGAACAGTTTCCATTCCAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026437.1-649s1c1
Sequence:CCGGCATTCTTACATGCACCTTCATCTCGAGATGAAGGTGCATGTAAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026437.1-745s1c1
Sequence:CCGGCCAGACCTCTATGACGTGTTTCTCGAGAAACACGTCATAGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026437.2-1049s21c1
Sequence:CCGGTCTAGCAGCAGCTGAACAAATCTCGAGATTTGTTCAGCTGCTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026437.2-836s21c1
Sequence:CCGGTAAAGAGATTGGTCAACTAATCTCGAGATTAGTTGACCAATCTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026437.2-745s21c1
Sequence:CCGGCAGACCTCTATGACGTGTTTGCTCGAGCAAACACGTCATAGAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026437.2-315s21c1
Sequence:CCGGGCCGCCTTCACTAGGATATTGCTCGAGCAATATCCTAGTGAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026437.2-1129s21c1
Sequence:CCGGTCCTAGTACCCATTGACATTACTCGAGTAATGTCAATGGGTACTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026437.2-479s1c1
Sequence:CCGGCTCCATCAAAGACATTGTATCCTCGAGGATACAATGTCTTTGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026437
VALIDATED
FAM45A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 45, member A
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026437.1-882s1c1
Sequence:CCGGGAAATCAGACAGCCAGGTTATCTCGAGATAACCTGGCTGTCTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026437.1-760s1c1
Sequence:CCGGGTGTTTGTGAATCTGGCAGATCTCGAGATCTGCCAGATTCACAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026437.1-832s1c1
Sequence:CCGGCTGCATAAAGAGATTGGTCAACTCGAGTTGACCAATCTCTTTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026437.1-1867s1c1
Sequence:CCGGCCAGCCCATAATGCTTTCATACTCGAGTATGAAAGCATTATGGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026437.1-502s1c1
Sequence:CCGGCAATTTGGAATGGAAACTGTTCTCGAGAACAGTTTCCATTCCAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026437.1-649s1c1
Sequence:CCGGCATTCTTACATGCACCTTCATCTCGAGATGAAGGTGCATGTAAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026437.1-745s1c1
Sequence:CCGGCCAGACCTCTATGACGTGTTTCTCGAGAAACACGTCATAGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026437.2-1049s21c1
Sequence:CCGGTCTAGCAGCAGCTGAACAAATCTCGAGATTTGTTCAGCTGCTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026437.2-836s21c1
Sequence:CCGGTAAAGAGATTGGTCAACTAATCTCGAGATTAGTTGACCAATCTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026437.2-745s21c1
Sequence:CCGGCAGACCTCTATGACGTGTTTGCTCGAGCAAACACGTCATAGAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026437.2-315s21c1
Sequence:CCGGGCCGCCTTCACTAGGATATTGCTCGAGCAATATCCTAGTGAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026437.2-1129s21c1
Sequence:CCGGTCCTAGTACCCATTGACATTACTCGAGTAATGTCAATGGGTACTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026437.2-479s1c1
Sequence:CCGGCTCCATCAAAGACATTGTATCCTCGAGGATACAATGTCTTTGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207009
FAM45A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 45, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207009.2-142s1c1
Sequence:CCGGCTTCCACGACAGCCACATTAACTCGAGTTAATGTGGCTGTCGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207009.2-780s1c1
Sequence:CCGGCCAGACCTCTATGATGTGTTTCTCGAGAAACACATCATAGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207009.2-1973s1c1
Sequence:CCGGGCAACTTCGATGAAAGTAGTTCTCGAGAACTACTTTCATCGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207009.2-1406s1c1
Sequence:CCGGGCACATCACAACAAATGTGAACTCGAGTTCACATTTGTTGTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207009.2-1022s1c1
Sequence:CCGGCCTTAATTTGGAGGCGCTAAACTCGAGTTTAGCGCCTCCAAATTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207009.2-810s1c1
Sequence:CCGGGCAGAGAGTGAGATTACCATTCTCGAGAATGGTAATCTCACTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207009.2-1966s1c1
Sequence:CCGGGCTTCCAGCAACTTCGATGAACTCGAGTTCATCGAAGTTGCTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207009.2-1620s1c1
Sequence:CCGGGCAGTTGCACTTTCTCGTAAACTCGAGTTTACGAGAAAGTGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207009.2-915s1c1
Sequence:CCGGGAGAAATCAGAGAGCCACGTTCTCGAGAACGTGGCTCTCTGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207009
FAM45A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 45, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207009.2-142s1c1
Sequence:CCGGCTTCCACGACAGCCACATTAACTCGAGTTAATGTGGCTGTCGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207009.2-780s1c1
Sequence:CCGGCCAGACCTCTATGATGTGTTTCTCGAGAAACACATCATAGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207009.2-1973s1c1
Sequence:CCGGGCAACTTCGATGAAAGTAGTTCTCGAGAACTACTTTCATCGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207009.2-1406s1c1
Sequence:CCGGGCACATCACAACAAATGTGAACTCGAGTTCACATTTGTTGTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207009.2-1022s1c1
Sequence:CCGGCCTTAATTTGGAGGCGCTAAACTCGAGTTTAGCGCCTCCAAATTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207009.2-810s1c1
Sequence:CCGGGCAGAGAGTGAGATTACCATTCTCGAGAATGGTAATCTCACTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207009.2-1966s1c1
Sequence:CCGGGCTTCCAGCAACTTCGATGAACTCGAGTTCATCGAAGTTGCTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207009.2-1620s1c1
Sequence:CCGGGCAGTTGCACTTTCTCGTAAACTCGAGTTTACGAGAAAGTGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207009.2-915s1c1
Sequence:CCGGGAGAAATCAGAGAGCCACGTTCTCGAGAACGTGGCTCTCTGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207009
FAM45A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 45, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207009.2-142s1c1
Sequence:CCGGCTTCCACGACAGCCACATTAACTCGAGTTAATGTGGCTGTCGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207009.2-780s1c1
Sequence:CCGGCCAGACCTCTATGATGTGTTTCTCGAGAAACACATCATAGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207009.2-1973s1c1
Sequence:CCGGGCAACTTCGATGAAAGTAGTTCTCGAGAACTACTTTCATCGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207009.2-1406s1c1
Sequence:CCGGGCACATCACAACAAATGTGAACTCGAGTTCACATTTGTTGTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207009.2-1022s1c1
Sequence:CCGGCCTTAATTTGGAGGCGCTAAACTCGAGTTTAGCGCCTCCAAATTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207009.2-810s1c1
Sequence:CCGGGCAGAGAGTGAGATTACCATTCTCGAGAATGGTAATCTCACTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207009.2-1966s1c1
Sequence:CCGGGCTTCCAGCAACTTCGATGAACTCGAGTTCATCGAAGTTGCTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207009.2-1620s1c1
Sequence:CCGGGCAGTTGCACTTTCTCGTAAACTCGAGTTTACGAGAAAGTGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207009.2-915s1c1
Sequence:CCGGGAGAAATCAGAGAGCCACGTTCTCGAGAACGTGGCTCTCTGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks