EMAIL THIS PAGE TO A FRIEND

FAM45B

family with sequence similarity 45, member B (pseudogene)

95 Gene Product Result for
Synonyms: HT011
Species: Human FAM45B(55855)
UniProtKB ID: Q6NSW5, Q5H9G7, Q9NZ36
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2106081 Anti-FAM45B antibody produced in rabbit affinity isolated antibody horse, guinea pig, human, rabbit
western blot pricing
SAB2106082 Anti-FAM45B antibody produced in rabbit affinity isolated antibody horse, human, guinea pig, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018472 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018472 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154581 predicted 1274
2 SASI_Hs01_00154580 predicted 585
3 SASI_Hs01_00154583 predicted 882
4 SASI_Hs02_00352041 predicted 515
5 SASI_Hs01_00154584 predicted 1220
6 SASI_Hs01_00154585 predicted 688
7 SASI_Hs02_00352042 predicted 1193
8 SASI_Hs02_00352043 predicted 1271
9 SASI_Hs02_00352044 predicted 1001
10 SASI_Hs02_00352045 predicted 531
11 SASI_Hs01_00154582 predicted 1200
12 SASI_Hs01_00154586 predicted 1298
13 SASI_Hs01_00154587 predicted 1107
14 SASI_Hs01_00154588 predicted 1066
15 SASI_Hs01_00154589 predicted 1354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018472
FAM45B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 45, member B (pseudogene)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018472.1-1320s1c1
Sequence:CCGGGACTGATAGAAAGCCCTCTTTCTCGAGAAAGAGGGCTTTCTATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018472.1-1307s1c1
Sequence:CCGGCCGTATCACTGATGACTGATACTCGAGTATCAGTCATCAGTGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018472.1-1044s1c1
Sequence:CCGGCACAAAGAAATGGGTCAGCTACTCGAGTAGCTGACCCATTTCTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018472.1-920s1c1
Sequence:CCGGCGCTGGATTTGTAGACTTGGACTCGAGTCCAAGTCTACAAATCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018472.1-684s1c1
Sequence:CCGGGCTGGCTCCATCAAAGACATTCTCGAGAATGTCTTTGATGGAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018472.1-1029s1c1
Sequence:CCGGGCAATGGGCAAACTGCACAAACTCGAGTTTGTGCAGTTTGCCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018472.1-294s1c1
Sequence:CCGGGTTCTGTGGGTGTGGTGTTATCTCGAGATAACACCACACCCACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018472.1-1514s1c1
Sequence:CCGGCGAAGTGCTATAACTACTTTACTCGAGTAAAGTAGTTATAGCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018472
FAM45B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 45, member B (pseudogene)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018472.1-1320s1c1
Sequence:CCGGGACTGATAGAAAGCCCTCTTTCTCGAGAAAGAGGGCTTTCTATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018472.1-1307s1c1
Sequence:CCGGCCGTATCACTGATGACTGATACTCGAGTATCAGTCATCAGTGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018472.1-1044s1c1
Sequence:CCGGCACAAAGAAATGGGTCAGCTACTCGAGTAGCTGACCCATTTCTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018472.1-920s1c1
Sequence:CCGGCGCTGGATTTGTAGACTTGGACTCGAGTCCAAGTCTACAAATCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018472.1-684s1c1
Sequence:CCGGGCTGGCTCCATCAAAGACATTCTCGAGAATGTCTTTGATGGAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018472.1-1029s1c1
Sequence:CCGGGCAATGGGCAAACTGCACAAACTCGAGTTTGTGCAGTTTGCCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018472.1-294s1c1
Sequence:CCGGGTTCTGTGGGTGTGGTGTTATCTCGAGATAACACCACACCCACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018472.1-1514s1c1
Sequence:CCGGCGAAGTGCTATAACTACTTTACTCGAGTAAAGTAGTTATAGCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018472
FAM45B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 45, member B (pseudogene)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018472.1-1320s1c1
Sequence:CCGGGACTGATAGAAAGCCCTCTTTCTCGAGAAAGAGGGCTTTCTATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018472.1-1307s1c1
Sequence:CCGGCCGTATCACTGATGACTGATACTCGAGTATCAGTCATCAGTGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018472.1-1044s1c1
Sequence:CCGGCACAAAGAAATGGGTCAGCTACTCGAGTAGCTGACCCATTTCTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018472.1-920s1c1
Sequence:CCGGCGCTGGATTTGTAGACTTGGACTCGAGTCCAAGTCTACAAATCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018472.1-684s1c1
Sequence:CCGGGCTGGCTCCATCAAAGACATTCTCGAGAATGTCTTTGATGGAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018472.1-1029s1c1
Sequence:CCGGGCAATGGGCAAACTGCACAAACTCGAGTTTGTGCAGTTTGCCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018472.1-294s1c1
Sequence:CCGGGTTCTGTGGGTGTGGTGTTATCTCGAGATAACACCACACCCACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018472.1-1514s1c1
Sequence:CCGGCGAAGTGCTATAACTACTTTACTCGAGTAAAGTAGTTATAGCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks