EMAIL THIS PAGE TO A FRIEND

FAM46A

family with sequence similarity 46, member A

325 Gene Product Result for
Synonyms: C6orf37 XTP11
UniProtKB ID: Q96IP4, A8K7U4, Q5TF86, Q8NFZ9, Q9BW32, Q9NXV5
Gene ID:
Mouse(212943) family with sequence similarity 46, member A
Rat(300870) family with sequence similarity 46, member A
Zebrafish(571146) family with sequence similarity 46, member A
chicken(421845) family with sequence similarity 46, member A
domestic cat(101081138) family with sequence similarity 46, member A
cow(540234) family with sequence similarity 46, member A
domestic guinea pig(100727603) family with sequence similarity 46, member A
naked mole-rat(101723537) family with sequence similarity 46, member A
sheep(101120584) family with sequence similarity 46, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017633 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001160378 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001160378 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001160378 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046481 MISSION® esiRNA esiRNA human FAM46A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017633 Rosetta Predictions human pricing
NM_001106844 Rosetta Predictions rat pricing
XM_135029 Rosetta Predictions mouse pricing
XM_918327 Rosetta Predictions mouse pricing
XM_925654 Rosetta Predictions mouse pricing
XM_994662 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235758 predicted 927
2 SASI_Hs01_00235759 predicted 884
3 SASI_Hs01_00235760 predicted 1105
4 SASI_Hs01_00235761 predicted 1115
5 SASI_Hs01_00235762 predicted 952
6 SASI_Hs01_00235763 predicted 1064
7 SASI_Hs01_00235764 predicted 1051
8 SASI_Hs02_00350313 predicted 1219
9 SASI_Hs02_00350314 predicted 916
10 SASI_Hs02_00350315 predicted 1239
11 SASI_Hs01_00235757 predicted 1253
12 SASI_Hs01_00235765 predicted 1249
13 SASI_Hs01_00235766 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222956 predicted 1346
2 SASI_Rn02_00222957 predicted 1294
3 SASI_Rn02_00222958 predicted 351
4 SASI_Rn02_00222959 predicted 871
5 SASI_Rn02_00222960 predicted 907
6 SASI_Rn02_00222961 predicted 1119
7 SASI_Rn02_00222962 predicted 1069
8 SASI_Rn02_00222963 predicted 819
9 SASI_Rn02_00222964 predicted 1244
10 SASI_Rn02_00222965 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_135029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223382 predicted 1164
2 SASI_Mm01_00223383 predicted 1046
3 SASI_Mm01_00223386 predicted 842
4 SASI_Mm01_00223387 predicted 644
5 SASI_Mm01_00223388 predicted 350
6 SASI_Mm01_00223389 predicted 566
7 SASI_Mm01_00223390 predicted 394
8 SASI_Mm01_00223391 predicted 1122
9 SASI_Mm02_00424603 predicted 883
10 SASI_Mm02_00424604 predicted 1083
11 SASI_Mm01_00223384 predicted 991
12 SASI_Mm01_00223385 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_918327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441799 predicted 1195
2 SASI_Mm02_00441800 predicted 1071
3 SASI_Mm02_00441801 predicted 209
4 SASI_Mm02_00441802 predicted 880
5 SASI_Mm02_00441803 predicted 673
6 SASI_Mm02_00441804 predicted 376
7 SASI_Mm02_00441805 predicted 594
8 SASI_Mm02_00441806 predicted 419
9 SASI_Mm02_00441807 predicted 1157
10 SASI_Mm02_00441808 predicted 911
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_925654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444625 predicted 1163
2 SASI_Mm02_00444626 predicted 1043
3 SASI_Mm02_00444627 predicted 846
4 SASI_Mm02_00444628 predicted 645
5 SASI_Mm02_00444629 predicted 341
6 SASI_Mm02_00444630 predicted 567
7 SASI_Mm02_00444631 predicted 389
8 SASI_Mm02_00444632 predicted 1120
9 SASI_Mm02_00444633 predicted 882
10 SASI_Mm02_00444634 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250032 predicted 1197
2 SASI_Mm01_00250033 predicted 1071
3 SASI_Mm01_00250035 predicted 207
4 SASI_Mm01_00250036 predicted 872
5 SASI_Mm01_00250037 predicted 670
6 SASI_Mm01_00250038 predicted 379
7 SASI_Mm01_00250039 predicted 595
8 SASI_Mm01_00250040 predicted 422
9 SASI_Mm01_00250041 predicted 1157
10 SASI_Mm02_00451844 predicted 906
11 SASI_Mm01_00250034 predicted 867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017633
VALIDATED
FAM46A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 46, member A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017633.1-1415s1c1
Sequence:CCGGCATGAAAGAAGACAGACTTTACTCGAGTAAAGTCTGTCTTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017633.2-1102s21c1
Sequence:CCGGGAGAGCGTCTATGGCGATTTCCTCGAGGAAATCGCCATAGACGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017633.2-1355s21c1
Sequence:CCGGGATTGGAAGACCGCAAGTATGCTCGAGCATACTTGCGGTCTTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017633.2-1139s21c1
Sequence:CCGGACCTTTGTAACAAGATCATTGCTCGAGCAATGATCTTGTTACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017633.2-4848s21c1
Sequence:CCGGTGGTATTGGATGGACTAATAACTCGAGTTATTAGTCCATCCAATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017633.2-1628s21c1
Sequence:CCGGCTTGGCTACCCTGCAATTAAGCTCGAGCTTAATTGCAGGGTAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017633
VALIDATED
FAM46A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 46, member A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017633.1-1415s1c1
Sequence:CCGGCATGAAAGAAGACAGACTTTACTCGAGTAAAGTCTGTCTTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017633.2-1102s21c1
Sequence:CCGGGAGAGCGTCTATGGCGATTTCCTCGAGGAAATCGCCATAGACGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017633.2-1355s21c1
Sequence:CCGGGATTGGAAGACCGCAAGTATGCTCGAGCATACTTGCGGTCTTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017633.2-1139s21c1
Sequence:CCGGACCTTTGTAACAAGATCATTGCTCGAGCAATGATCTTGTTACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017633.2-4848s21c1
Sequence:CCGGTGGTATTGGATGGACTAATAACTCGAGTTATTAGTCCATCCAATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017633.2-1628s21c1
Sequence:CCGGCTTGGCTACCCTGCAATTAAGCTCGAGCTTAATTGCAGGGTAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017633
VALIDATED
FAM46A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 46, member A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017633.1-1415s1c1
Sequence:CCGGCATGAAAGAAGACAGACTTTACTCGAGTAAAGTCTGTCTTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017633.2-1102s21c1
Sequence:CCGGGAGAGCGTCTATGGCGATTTCCTCGAGGAAATCGCCATAGACGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017633.2-1355s21c1
Sequence:CCGGGATTGGAAGACCGCAAGTATGCTCGAGCATACTTGCGGTCTTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017633.2-1139s21c1
Sequence:CCGGACCTTTGTAACAAGATCATTGCTCGAGCAATGATCTTGTTACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017633.2-4848s21c1
Sequence:CCGGTGGTATTGGATGGACTAATAACTCGAGTTATTAGTCCATCCAATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017633.2-1628s21c1
Sequence:CCGGCTTGGCTACCCTGCAATTAAGCTCGAGCTTAATTGCAGGGTAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001160378
FAM46A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 46, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160378.1-953s21c1
Sequence:CCGGACCTTTGCAACAAGATCATTGCTCGAGCAATGATCTTGTTGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160378.1-705s21c1
Sequence:CCGGGGTTAAAGTGTGCAATGATTCCTCGAGGAATCATTGCACACTTTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160378.1-1442s21c1
Sequence:CCGGCTTGGTTACCCTGCAACTAAGCTCGAGCTTAGTTGCAGGGTAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160378.1-1326s21c1
Sequence:CCGGGGCTAATGTCACTTGCTATTACTCGAGTAATAGCAAGTGACATTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160378.1-1583s21c1
Sequence:CCGGGAAGTGACCCAGTCCTAATTACTCGAGTAATTAGGACTGGGTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001160378
FAM46A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 46, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160378.1-953s21c1
Sequence:CCGGACCTTTGCAACAAGATCATTGCTCGAGCAATGATCTTGTTGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160378.1-705s21c1
Sequence:CCGGGGTTAAAGTGTGCAATGATTCCTCGAGGAATCATTGCACACTTTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160378.1-1442s21c1
Sequence:CCGGCTTGGTTACCCTGCAACTAAGCTCGAGCTTAGTTGCAGGGTAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160378.1-1326s21c1
Sequence:CCGGGGCTAATGTCACTTGCTATTACTCGAGTAATAGCAAGTGACATTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160378.1-1583s21c1
Sequence:CCGGGAAGTGACCCAGTCCTAATTACTCGAGTAATTAGGACTGGGTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001160378
FAM46A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 46, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160378.1-953s21c1
Sequence:CCGGACCTTTGCAACAAGATCATTGCTCGAGCAATGATCTTGTTGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160378.1-705s21c1
Sequence:CCGGGGTTAAAGTGTGCAATGATTCCTCGAGGAATCATTGCACACTTTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160378.1-1442s21c1
Sequence:CCGGCTTGGTTACCCTGCAACTAAGCTCGAGCTTAGTTGCAGGGTAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160378.1-1326s21c1
Sequence:CCGGGGCTAATGTCACTTGCTATTACTCGAGTAATAGCAAGTGACATTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160378.1-1583s21c1
Sequence:CCGGGAAGTGACCCAGTCCTAATTACTCGAGTAATTAGGACTGGGTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks