EMAIL THIS PAGE TO A FRIEND

FAM46B

family with sequence similarity 46, member B

101 Gene Product Result for
Synonyms: RP11-344H11.8
UniProtKB ID: Q96A09
Gene ID:
Mouse(100342) family with sequence similarity 46, member B
Rat(313019) family with sequence similarity 46, member B
sheep(101109074) family with sequence similarity 46, member B
naked mole-rat(101723830) family with sequence similarity 46, member B
domestic guinea pig(100725479) family with sequence similarity 46, member B
chicken(430080) family with sequence similarity 46, member B
cow(506745) family with sequence similarity 46, member B
domestic cat(101088503) family with sequence similarity 46, member B
dog(487348) family with sequence similarity 46, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052943 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175307 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175307 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175307 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052943 Rosetta Predictions human pricing
NM_001107907 Rosetta Predictions rat pricing
NM_175307 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148093 predicted 1885
2 SASI_Hs01_00148094 predicted 728
3 SASI_Hs01_00148095 predicted 1752
4 SASI_Hs01_00148096 predicted 1777
5 SASI_Hs02_00361729 predicted 1194
6 SASI_Hs01_00148097 predicted 1717
7 SASI_Hs01_00148099 predicted 1177
8 SASI_Hs02_00361730 predicted 631
9 SASI_Hs02_00361731 predicted 1550
10 SASI_Hs01_00148101 predicted 765
11 SASI_Hs01_00148092 predicted 1353
12 SASI_Hs01_00148098 predicted 1776
13 SASI_Hs01_00148100 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233455 predicted 441
2 SASI_Rn02_00233456 predicted 1165
3 SASI_Rn02_00233457 predicted 1478
4 SASI_Rn02_00233458 predicted 794
5 SASI_Rn02_00233459 predicted 620
6 SASI_Rn02_00233460 predicted 1209
7 SASI_Rn02_00233461 predicted 1038
8 SASI_Rn02_00233462 predicted 430
9 SASI_Rn02_00233463 predicted 1059
10 SASI_Rn02_00233464 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346064 predicted 1651
2 SASI_Mm01_00072234 predicted 1807
3 SASI_Mm01_00072235 predicted 1819
4 SASI_Mm01_00072236 predicted 1068
5 SASI_Mm01_00072238 predicted 1906
6 SASI_Mm01_00072239 predicted 1883
7 SASI_Mm01_00072240 predicted 1500
8 SASI_Mm01_00072241 predicted 1578
9 SASI_Mm01_00072242 predicted 442
10 SASI_Mm01_00072243 predicted 869
11 SASI_Mm01_00072237 predicted 752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052943
VALIDATED
FAM46B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 46, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052943.3-1366s21c1
Sequence:CCGGTGTGCCAGCCACTGTCAATTACTCGAGTAATTGACAGTGGCTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052943.3-1092s21c1
Sequence:CCGGCCCGCTTCTTCATCGACTTTCCTCGAGGAAAGTCGATGAAGAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052943.3-791s21c1
Sequence:CCGGTCGGTGAGACGCCAGTTTGAACTCGAGTTCAAACTGGCGTCTCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052943.3-1774s21c1
Sequence:CCGGCCCAGCACCTTGGATTGATTCCTCGAGGAATCAATCCAAGGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052943.3-748s21c1
Sequence:CCGGGTCCAACAAGAGCGGCAAGAACTCGAGTTCTTGCCGCTCTTGTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052943.2-1364s1c1
Sequence:CCGGCCAGCCACTGTCAATTACTACCTCGAGGTAGTAATTGACAGTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052943.2-730s1c1
Sequence:CCGGCCTCATCTCACTGTCCAACAACTCGAGTTGTTGGACAGTGAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052943.2-808s1c1
Sequence:CCGGCAGCATAGACTCCTTCCAGATCTCGAGATCTGGAAGGAGTCTATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052943
VALIDATED
FAM46B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 46, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052943.3-1366s21c1
Sequence:CCGGTGTGCCAGCCACTGTCAATTACTCGAGTAATTGACAGTGGCTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052943.3-1092s21c1
Sequence:CCGGCCCGCTTCTTCATCGACTTTCCTCGAGGAAAGTCGATGAAGAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052943.3-791s21c1
Sequence:CCGGTCGGTGAGACGCCAGTTTGAACTCGAGTTCAAACTGGCGTCTCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052943.3-1774s21c1
Sequence:CCGGCCCAGCACCTTGGATTGATTCCTCGAGGAATCAATCCAAGGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052943.3-748s21c1
Sequence:CCGGGTCCAACAAGAGCGGCAAGAACTCGAGTTCTTGCCGCTCTTGTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052943.2-1364s1c1
Sequence:CCGGCCAGCCACTGTCAATTACTACCTCGAGGTAGTAATTGACAGTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052943.2-730s1c1
Sequence:CCGGCCTCATCTCACTGTCCAACAACTCGAGTTGTTGGACAGTGAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052943.2-808s1c1
Sequence:CCGGCAGCATAGACTCCTTCCAGATCTCGAGATCTGGAAGGAGTCTATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052943
VALIDATED
FAM46B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 46, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052943.3-1366s21c1
Sequence:CCGGTGTGCCAGCCACTGTCAATTACTCGAGTAATTGACAGTGGCTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052943.3-1092s21c1
Sequence:CCGGCCCGCTTCTTCATCGACTTTCCTCGAGGAAAGTCGATGAAGAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052943.3-791s21c1
Sequence:CCGGTCGGTGAGACGCCAGTTTGAACTCGAGTTCAAACTGGCGTCTCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052943.3-1774s21c1
Sequence:CCGGCCCAGCACCTTGGATTGATTCCTCGAGGAATCAATCCAAGGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052943.3-748s21c1
Sequence:CCGGGTCCAACAAGAGCGGCAAGAACTCGAGTTCTTGCCGCTCTTGTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052943.2-1364s1c1
Sequence:CCGGCCAGCCACTGTCAATTACTACCTCGAGGTAGTAATTGACAGTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052943.2-730s1c1
Sequence:CCGGCCTCATCTCACTGTCCAACAACTCGAGTTGTTGGACAGTGAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052943.2-808s1c1
Sequence:CCGGCAGCATAGACTCCTTCCAGATCTCGAGATCTGGAAGGAGTCTATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175307
FAM46B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 46, member B
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175307.2-812s1c1
Sequence:CCGGCGACTCCTTCCAAATCATCTTCTCGAGAAGATGATTTGGAAGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175307.2-728s1c1
Sequence:CCGGCCTCATCTCTCTGTCCAACAACTCGAGTTGTTGGACAGAGAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194232    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175307.2-1896s1c1
Sequence:CCGGGCTGATCACTAGGAAGAGATACTCGAGTATCTCTTCCTAGTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175307.2-1076s1c2
Sequence:CCGGCATGTGTTCCCGTTTCTTCATCTCGAGATGAAGAAACGGGAACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175307.2-817s1c2
Sequence:CCGGCCTTCCAAATCATCTTGGACTCTCGAGAGTCCAAGATGATTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175307.2-1908s1c1
Sequence:CCGGGAAGAGATAAACTAAGGCATACTCGAGTATGCCTTAGTTTATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175307
FAM46B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 46, member B
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175307.2-812s1c1
Sequence:CCGGCGACTCCTTCCAAATCATCTTCTCGAGAAGATGATTTGGAAGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175307.2-728s1c1
Sequence:CCGGCCTCATCTCTCTGTCCAACAACTCGAGTTGTTGGACAGAGAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194232    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175307.2-1896s1c1
Sequence:CCGGGCTGATCACTAGGAAGAGATACTCGAGTATCTCTTCCTAGTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175307.2-1076s1c2
Sequence:CCGGCATGTGTTCCCGTTTCTTCATCTCGAGATGAAGAAACGGGAACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175307.2-817s1c2
Sequence:CCGGCCTTCCAAATCATCTTGGACTCTCGAGAGTCCAAGATGATTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175307.2-1908s1c1
Sequence:CCGGGAAGAGATAAACTAAGGCATACTCGAGTATGCCTTAGTTTATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175307
FAM46B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 46, member B
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175307.2-812s1c1
Sequence:CCGGCGACTCCTTCCAAATCATCTTCTCGAGAAGATGATTTGGAAGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175307.2-728s1c1
Sequence:CCGGCCTCATCTCTCTGTCCAACAACTCGAGTTGTTGGACAGAGAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194232    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175307.2-1896s1c1
Sequence:CCGGGCTGATCACTAGGAAGAGATACTCGAGTATCTCTTCCTAGTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175307.2-1076s1c2
Sequence:CCGGCATGTGTTCCCGTTTCTTCATCTCGAGATGAAGAAACGGGAACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175307.2-817s1c2
Sequence:CCGGCCTTCCAAATCATCTTGGACTCTCGAGAGTCCAAGATGATTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175307.2-1908s1c1
Sequence:CCGGGAAGAGATAAACTAAGGCATACTCGAGTATGCCTTAGTTTATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks