EMAIL THIS PAGE TO A FRIEND

FAM46C

family with sequence similarity 46, member C

317 Gene Product Result for
UniProtKB ID: Q5VWP2, A3KMG2, Q8NE25, Q9NXK0
Gene ID:
Mouse(74645) family with sequence similarity 46, member C
Rat(310721) family with sequence similarity 46, member C
Zebrafish(327154) family with sequence similarity 46, member C
dog(483142) family with sequence similarity 46, member C
cow(517961) family with sequence similarity 46, member C
domestic cat(101087084) family with sequence similarity 46, member C
chicken(426544) family with sequence similarity 46, member C
domestic guinea pig(100724434) family with sequence similarity 46, member C
naked mole-rat(101701291) family with sequence similarity 46, member C
sheep(101108706) family with sequence similarity 46, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017709 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001142952 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001142952 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001142952 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131011 MISSION® esiRNA esiRNA human FAM46C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017709 Rosetta Predictions human pricing
NM_001014041 Rosetta Predictions rat pricing
XR_001536 Rosetta Predictions mouse pricing
XR_002338 Rosetta Predictions mouse pricing
XR_005163 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178028 predicted 315
2 SASI_Hs01_00178030 predicted 294
3 SASI_Hs01_00178031 predicted 336
4 SASI_Hs01_00178027 predicted 1096
5 SASI_Hs01_00178029 predicted 458
6 SASI_Hs02_00350471 predicted 790
7 SASI_Hs01_00178033 predicted 944
8 SASI_Hs01_00178034 predicted 889
9 SASI_Hs01_00178035 predicted 710
10 SASI_Hs01_00178036 predicted 742
11 SASI_Hs01_00178032 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053584 predicted 922
2 SASI_Rn01_00053585 predicted 811
3 SASI_Rn01_00053586 predicted 1347
4 SASI_Rn02_00201430 predicted 715
5 SASI_Rn01_00053587 predicted 1154
6 SASI_Rn01_00053588 predicted 1382
7 SASI_Rn01_00053589 predicted 1059
8 SASI_Rn01_00053590 predicted 437
9 SASI_Rn01_00053591 predicted 814
10 SASI_Rn01_00053592 predicted 1148
11 SASI_Rn01_00053593 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_001536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00451937 predicted 302
2 SASI_Mm02_00451938 predicted 739
3 SASI_Mm02_00451939 predicted 1572
4 SASI_Mm02_00451940 predicted 1592
5 SASI_Mm02_00451941 predicted 1511
6 SASI_Mm02_00451942 predicted 983
7 SASI_Mm02_00451943 predicted 1743
8 SASI_Mm02_00451944 predicted 1563
9 SASI_Mm02_00451945 predicted 1576
10 SASI_Mm02_00451946 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_002338 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00452987 predicted 302
2 SASI_Mm02_00452988 predicted 739
3 SASI_Mm02_00452989 predicted 1570
4 SASI_Mm02_00452990 predicted 1599
5 SASI_Mm02_00452991 predicted 1517
6 SASI_Mm02_00452992 predicted 989
7 SASI_Mm02_00452993 predicted 1745
8 SASI_Mm02_00452994 predicted 1562
9 SASI_Mm02_00452995 predicted 1576
10 SASI_Mm02_00452996 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00453652 predicted 206
2 SASI_Mm02_00453653 predicted 633
3 SASI_Mm02_00453654 predicted 1474
4 SASI_Mm02_00453655 predicted 1498
5 SASI_Mm02_00453656 predicted 1420
6 SASI_Mm02_00453657 predicted 884
7 SASI_Mm02_00453658 predicted 1646
8 SASI_Mm02_00453659 predicted 1468
9 SASI_Mm02_00453660 predicted 1483
10 SASI_Mm02_00453661 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017709
FAM46C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 46, member C
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017709.2-697s1c1
Sequence:CCGGGCTGAAGTTTGTCGACTCCATCTCGAGATGGAGTCGACAAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017709.2-506s1c1
Sequence:CCGGGCAGAATTTCAGCTGGTTAGACTCGAGTCTAACCAGCTGAAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017709.2-283s1c1
Sequence:CCGGCCTCACTGAAGTTGTACCTATCTCGAGATAGGTACAACTTCAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166958    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017709.2-5213s1c1
Sequence:CCGGGCCTAAATCTTGTTTACCTATCTCGAGATAGGTAAACAAGATTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017709.2-778s1c1
Sequence:CCGGCTTCTATGACTGTTCCAATAACTCGAGTTATTGGAACAGTCATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017709.2-4566s1c1
Sequence:CCGGGCTGTGTATGAACTTGTGTTTCTCGAGAAACACAAGTTCATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017709.2-929s1c1
Sequence:CCGGCTTCTCAAGTACAGCAACCTTCTCGAGAAGGTTGCTGTACTTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017709.3-1443s21c1
Sequence:CCGGCCTTCTAGATGTAGGCATTTGCTCGAGCAAATGCCTACATCTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017709.3-461s21c1
Sequence:CCGGTGCAAAGACCTGGACCTAATCCTCGAGGATTAGGTCCAGGTCTTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017709.3-1691s21c1
Sequence:CCGGTAATCGAGATTGGGAGAATTTCTCGAGAAATTCTCCCAATCTCGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017709.3-318s21c1
Sequence:CCGGACTTTCCAACCTTGGAGATAACTCGAGTTATCTCCAAGGTTGGAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017709.3-1557s21c1
Sequence:CCGGACCCTCAAAGGACCCGTATTACTCGAGTAATACGGGTCCTTTGAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017709
FAM46C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 46, member C
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017709.2-697s1c1
Sequence:CCGGGCTGAAGTTTGTCGACTCCATCTCGAGATGGAGTCGACAAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017709.2-506s1c1
Sequence:CCGGGCAGAATTTCAGCTGGTTAGACTCGAGTCTAACCAGCTGAAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017709.2-283s1c1
Sequence:CCGGCCTCACTGAAGTTGTACCTATCTCGAGATAGGTACAACTTCAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166958    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017709.2-5213s1c1
Sequence:CCGGGCCTAAATCTTGTTTACCTATCTCGAGATAGGTAAACAAGATTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017709.2-778s1c1
Sequence:CCGGCTTCTATGACTGTTCCAATAACTCGAGTTATTGGAACAGTCATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017709.2-4566s1c1
Sequence:CCGGGCTGTGTATGAACTTGTGTTTCTCGAGAAACACAAGTTCATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017709.2-929s1c1
Sequence:CCGGCTTCTCAAGTACAGCAACCTTCTCGAGAAGGTTGCTGTACTTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017709.3-1443s21c1
Sequence:CCGGCCTTCTAGATGTAGGCATTTGCTCGAGCAAATGCCTACATCTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017709.3-461s21c1
Sequence:CCGGTGCAAAGACCTGGACCTAATCCTCGAGGATTAGGTCCAGGTCTTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017709.3-1691s21c1
Sequence:CCGGTAATCGAGATTGGGAGAATTTCTCGAGAAATTCTCCCAATCTCGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017709.3-318s21c1
Sequence:CCGGACTTTCCAACCTTGGAGATAACTCGAGTTATCTCCAAGGTTGGAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017709.3-1557s21c1
Sequence:CCGGACCCTCAAAGGACCCGTATTACTCGAGTAATACGGGTCCTTTGAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017709
FAM46C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 46, member C
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017709.2-697s1c1
Sequence:CCGGGCTGAAGTTTGTCGACTCCATCTCGAGATGGAGTCGACAAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017709.2-506s1c1
Sequence:CCGGGCAGAATTTCAGCTGGTTAGACTCGAGTCTAACCAGCTGAAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017709.2-283s1c1
Sequence:CCGGCCTCACTGAAGTTGTACCTATCTCGAGATAGGTACAACTTCAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166958    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017709.2-5213s1c1
Sequence:CCGGGCCTAAATCTTGTTTACCTATCTCGAGATAGGTAAACAAGATTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017709.2-778s1c1
Sequence:CCGGCTTCTATGACTGTTCCAATAACTCGAGTTATTGGAACAGTCATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017709.2-4566s1c1
Sequence:CCGGGCTGTGTATGAACTTGTGTTTCTCGAGAAACACAAGTTCATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017709.2-929s1c1
Sequence:CCGGCTTCTCAAGTACAGCAACCTTCTCGAGAAGGTTGCTGTACTTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017709.3-1443s21c1
Sequence:CCGGCCTTCTAGATGTAGGCATTTGCTCGAGCAAATGCCTACATCTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017709.3-461s21c1
Sequence:CCGGTGCAAAGACCTGGACCTAATCCTCGAGGATTAGGTCCAGGTCTTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017709.3-1691s21c1
Sequence:CCGGTAATCGAGATTGGGAGAATTTCTCGAGAAATTCTCCCAATCTCGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017709.3-318s21c1
Sequence:CCGGACTTTCCAACCTTGGAGATAACTCGAGTTATCTCCAAGGTTGGAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017709.3-1557s21c1
Sequence:CCGGACCCTCAAAGGACCCGTATTACTCGAGTAATACGGGTCCTTTGAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001142952
FAM46C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 46, member C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142952.1-1242s21c1
Sequence:CCGGCATTGCGCACCCTCCAATTACCTCGAGGTAATTGGAGGGTGCGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142952.1-482s21c1
Sequence:CCGGTTCTGCCAGAGGGCGTGAATACTCGAGTATTCACGCCCTCTGGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142952.1-1661s21c1
Sequence:CCGGAGCTGAGTTCTCGGTAGATTCCTCGAGGAATCTACCGAGAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142952.1-1034s21c1
Sequence:CCGGAGTACGACTACCTCATGATTCCTCGAGGAATCATGAGGTAGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142952.1-723s21c1
Sequence:CCGGCAATCCCATCTCCGAGCATTTCTCGAGAAATGCTCGGAGATGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001142952
FAM46C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 46, member C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142952.1-1242s21c1
Sequence:CCGGCATTGCGCACCCTCCAATTACCTCGAGGTAATTGGAGGGTGCGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142952.1-482s21c1
Sequence:CCGGTTCTGCCAGAGGGCGTGAATACTCGAGTATTCACGCCCTCTGGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142952.1-1661s21c1
Sequence:CCGGAGCTGAGTTCTCGGTAGATTCCTCGAGGAATCTACCGAGAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142952.1-1034s21c1
Sequence:CCGGAGTACGACTACCTCATGATTCCTCGAGGAATCATGAGGTAGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142952.1-723s21c1
Sequence:CCGGCAATCCCATCTCCGAGCATTTCTCGAGAAATGCTCGGAGATGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001142952
FAM46C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 46, member C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142952.1-1242s21c1
Sequence:CCGGCATTGCGCACCCTCCAATTACCTCGAGGTAATTGGAGGGTGCGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142952.1-482s21c1
Sequence:CCGGTTCTGCCAGAGGGCGTGAATACTCGAGTATTCACGCCCTCTGGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142952.1-1661s21c1
Sequence:CCGGAGCTGAGTTCTCGGTAGATTCCTCGAGGAATCTACCGAGAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142952.1-1034s21c1
Sequence:CCGGAGTACGACTACCTCATGATTCCTCGAGGAATCATGAGGTAGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142952.1-723s21c1
Sequence:CCGGCAATCCCATCTCCGAGCATTTCTCGAGAAATGCTCGGAGATGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks