EMAIL THIS PAGE TO A FRIEND

FAM46D

family with sequence similarity 46, member D

40 Gene Product Result for
Synonyms: CT1.26 CT112
UniProtKB ID: Q8NEK8, Q7Z3F6, Q8NHU1
Gene ID:
Human(169966) Summary: Antibodies against the protein encoded by this gene were found only in plasma from cancer patients. While it may be a target for immunotherapy, the function of this gene is unknown. [provided by RefSeq, Dec 2009]
Mouse(213449) family with sequence similarity 46, member D
Rat(302368) family with sequence similarity 46, member D
sheep(101120141) family with sequence similarity 46, member D
domestic guinea pig(100734722) family with sequence similarity 46, member D
chicken(422282) family with sequence similarity 46, member D
cow(100124506) family with sequence similarity 46, member D
domestic cat(101091679) family with sequence similarity 46, member D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152630 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152630 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152630 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064681 MISSION® esiRNA esiRNA human FAM46D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152630 Rosetta Predictions human pricing
NM_001106936 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038493 predicted 1013
2 SASI_Hs01_00038494 predicted 1162
3 SASI_Hs01_00038495 predicted 1190
4 SASI_Hs01_00038496 predicted 471
5 SASI_Hs01_00038497 predicted 284
6 SASI_Hs01_00038498 predicted 1376
7 SASI_Hs02_00366495 predicted 639
8 SASI_Hs01_00038499 predicted 1106
9 SASI_Hs01_00038501 predicted 259
10 SASI_Hs01_00038502 predicted 1138
11 SASI_Hs01_00038500 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223866 predicted 292
2 SASI_Rn02_00223867 predicted 987
3 SASI_Rn02_00223868 predicted 646
4 SASI_Rn02_00223869 predicted 1076
5 SASI_Rn02_00223870 predicted 284
6 SASI_Rn02_00223871 predicted 773
7 SASI_Rn02_00223872 predicted 1111
8 SASI_Rn02_00223873 predicted 233
9 SASI_Rn02_00223874 predicted 438
10 SASI_Rn02_00223875 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152630
FAM46D MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 46, member D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152630.4-497s21c1
Sequence:CCGGATAAGGATCTGGACGTTATTTCTCGAGAAATAACGTCCAGATCCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152630.4-1585s21c1
Sequence:CCGGCAATTAAGCCATCATAGTAAACTCGAGTTTACTATGATGGCTTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152630.4-1304s21c1
Sequence:CCGGATCAGCCTGCTCCGTACTTTGCTCGAGCAAAGTACGGAGCAGGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152630.4-1758s21c1
Sequence:CCGGGCCTGCATCTTTGACTATAACCTCGAGGTTATAGTCAAAGATGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152630.4-1645s21c1
Sequence:CCGGACGTTATTGACTAGCTATAATCTCGAGATTATAGCTAGTCAATAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168222    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152630.2-2776s1c1
Sequence:CCGGCCAGTTATAGACTGTGCTTATCTCGAGATAAGCACAGTCTATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152630.2-683s1c1
Sequence:CCGGCCTTTCAAATAACACTGGGAACTCGAGTTCCCAGTGTTATTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152630.2-1421s1c1
Sequence:CCGGGCAACCATAGAAACTTTGATTCTCGAGAATCAAAGTTTCTATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152630.2-1382s1c1
Sequence:CCGGCTTTCGTGGATCAAATGGTATCTCGAGATACCATTTGATCCACGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152630.2-288s1c1
Sequence:CCGGCTGGATCAAGTGTTAGATGAACTCGAGTTCATCTAACACTTGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152630
FAM46D MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 46, member D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152630.4-497s21c1
Sequence:CCGGATAAGGATCTGGACGTTATTTCTCGAGAAATAACGTCCAGATCCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152630.4-1585s21c1
Sequence:CCGGCAATTAAGCCATCATAGTAAACTCGAGTTTACTATGATGGCTTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152630.4-1304s21c1
Sequence:CCGGATCAGCCTGCTCCGTACTTTGCTCGAGCAAAGTACGGAGCAGGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152630.4-1758s21c1
Sequence:CCGGGCCTGCATCTTTGACTATAACCTCGAGGTTATAGTCAAAGATGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152630.4-1645s21c1
Sequence:CCGGACGTTATTGACTAGCTATAATCTCGAGATTATAGCTAGTCAATAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168222    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152630.2-2776s1c1
Sequence:CCGGCCAGTTATAGACTGTGCTTATCTCGAGATAAGCACAGTCTATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152630.2-683s1c1
Sequence:CCGGCCTTTCAAATAACACTGGGAACTCGAGTTCCCAGTGTTATTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152630.2-1421s1c1
Sequence:CCGGGCAACCATAGAAACTTTGATTCTCGAGAATCAAAGTTTCTATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152630.2-1382s1c1
Sequence:CCGGCTTTCGTGGATCAAATGGTATCTCGAGATACCATTTGATCCACGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152630.2-288s1c1
Sequence:CCGGCTGGATCAAGTGTTAGATGAACTCGAGTTCATCTAACACTTGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152630
FAM46D MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 46, member D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152630.4-497s21c1
Sequence:CCGGATAAGGATCTGGACGTTATTTCTCGAGAAATAACGTCCAGATCCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152630.4-1585s21c1
Sequence:CCGGCAATTAAGCCATCATAGTAAACTCGAGTTTACTATGATGGCTTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152630.4-1304s21c1
Sequence:CCGGATCAGCCTGCTCCGTACTTTGCTCGAGCAAAGTACGGAGCAGGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152630.4-1758s21c1
Sequence:CCGGGCCTGCATCTTTGACTATAACCTCGAGGTTATAGTCAAAGATGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152630.4-1645s21c1
Sequence:CCGGACGTTATTGACTAGCTATAATCTCGAGATTATAGCTAGTCAATAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168222    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152630.2-2776s1c1
Sequence:CCGGCCAGTTATAGACTGTGCTTATCTCGAGATAAGCACAGTCTATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152630.2-683s1c1
Sequence:CCGGCCTTTCAAATAACACTGGGAACTCGAGTTCCCAGTGTTATTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152630.2-1421s1c1
Sequence:CCGGGCAACCATAGAAACTTTGATTCTCGAGAATCAAAGTTTCTATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152630.2-1382s1c1
Sequence:CCGGCTTTCGTGGATCAAATGGTATCTCGAGATACCATTTGATCCACGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152630.2-288s1c1
Sequence:CCGGCTGGATCAAGTGTTAGATGAACTCGAGTTCATCTAACACTTGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks