EMAIL THIS PAGE TO A FRIEND

FAM47A

family with sequence similarity 47, member A

18 Gene Product Result for
UniProtKB ID: Q5JRC9, A8K8I9, Q8TAA0
Gene ID:
Rat(100362696) family with sequence similarity 47, member A
cow(100300042) family with sequence similarity 47, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203408 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152951 MISSION® esiRNA esiRNA human FAM47A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203408 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115228 predicted 1277
2 SASI_Hs01_00115229 predicted 929
3 SASI_Hs01_00115230 predicted 1747
4 SASI_Hs01_00115232 predicted 2209
5 SASI_Hs01_00115233 predicted 1303
6 SASI_Hs01_00115235 predicted 1291
7 SASI_Hs01_00115236 predicted 2199
8 SASI_Hs01_00115237 predicted 2362
9 SASI_Hs02_00373339 predicted 93
10 SASI_Hs01_00115231 predicted 1300
11 SASI_Hs01_00115234 predicted 1877
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203408
FAM47A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 47, member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203408.1-1308s1c1
Sequence:CCGGCCTACTATACATACTGAAAGTCTCGAGACTTTCAGTATGTATAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203408.1-2062s1c1
Sequence:CCGGCAGCGTGTGAAGATGAAGTATCTCGAGATACTTCATCTTCACACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203408.1-2177s1c1
Sequence:CCGGCTGACGTTCTTGACGATCTTTCTCGAGAAAGATCGTCAAGAACGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203408.1-2344s1c1
Sequence:CCGGGAAATCGTAGAGGCATCGGAACTCGAGTTCCGATGCCTCTACGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203408.1-2176s1c1
Sequence:CCGGCCTGACGTTCTTGACGATCTTCTCGAGAAGATCGTCAAGAACGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203408.1-1210s1c1
Sequence:CCGGCCCAAGACTGAAGTGTCTCATCTCGAGATGAGACACTTCAGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203408.1-1294s1c1
Sequence:CCGGCAGGTGTCCAATCTCCTACTACTCGAGTAGTAGGAGATTGGACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203408.1-227s1c1
Sequence:CCGGCTCCCGAAGATACTCTCGTTTCTCGAGAAACGAGAGTATCTTCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203408.1-1719s1c1
Sequence:CCGGGATTCGAGCATCCTACATAAACTCGAGTTTATGTAGGATGCTCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203408.1-2308s1c1
Sequence:CCGGCCTATTCAACGTGCAATGATACTCGAGTATCATTGCACGTTGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203408
FAM47A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 47, member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203408.1-1308s1c1
Sequence:CCGGCCTACTATACATACTGAAAGTCTCGAGACTTTCAGTATGTATAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203408.1-2062s1c1
Sequence:CCGGCAGCGTGTGAAGATGAAGTATCTCGAGATACTTCATCTTCACACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203408.1-2177s1c1
Sequence:CCGGCTGACGTTCTTGACGATCTTTCTCGAGAAAGATCGTCAAGAACGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203408.1-2344s1c1
Sequence:CCGGGAAATCGTAGAGGCATCGGAACTCGAGTTCCGATGCCTCTACGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203408.1-2176s1c1
Sequence:CCGGCCTGACGTTCTTGACGATCTTCTCGAGAAGATCGTCAAGAACGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203408.1-1210s1c1
Sequence:CCGGCCCAAGACTGAAGTGTCTCATCTCGAGATGAGACACTTCAGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203408.1-1294s1c1
Sequence:CCGGCAGGTGTCCAATCTCCTACTACTCGAGTAGTAGGAGATTGGACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203408.1-227s1c1
Sequence:CCGGCTCCCGAAGATACTCTCGTTTCTCGAGAAACGAGAGTATCTTCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203408.1-1719s1c1
Sequence:CCGGGATTCGAGCATCCTACATAAACTCGAGTTTATGTAGGATGCTCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203408.1-2308s1c1
Sequence:CCGGCCTATTCAACGTGCAATGATACTCGAGTATCATTGCACGTTGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203408
FAM47A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 47, member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203408.1-1308s1c1
Sequence:CCGGCCTACTATACATACTGAAAGTCTCGAGACTTTCAGTATGTATAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203408.1-2062s1c1
Sequence:CCGGCAGCGTGTGAAGATGAAGTATCTCGAGATACTTCATCTTCACACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203408.1-2177s1c1
Sequence:CCGGCTGACGTTCTTGACGATCTTTCTCGAGAAAGATCGTCAAGAACGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203408.1-2344s1c1
Sequence:CCGGGAAATCGTAGAGGCATCGGAACTCGAGTTCCGATGCCTCTACGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203408.1-2176s1c1
Sequence:CCGGCCTGACGTTCTTGACGATCTTCTCGAGAAGATCGTCAAGAACGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203408.1-1210s1c1
Sequence:CCGGCCCAAGACTGAAGTGTCTCATCTCGAGATGAGACACTTCAGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203408.1-1294s1c1
Sequence:CCGGCAGGTGTCCAATCTCCTACTACTCGAGTAGTAGGAGATTGGACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203408.1-227s1c1
Sequence:CCGGCTCCCGAAGATACTCTCGTTTCTCGAGAAACGAGAGTATCTTCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203408.1-1719s1c1
Sequence:CCGGGATTCGAGCATCCTACATAAACTCGAGTTTATGTAGGATGCTCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203408.1-2308s1c1
Sequence:CCGGCCTATTCAACGTGCAATGATACTCGAGTATCATTGCACGTTGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks